Incidental Mutation 'R0539:Lipn'
ID 49762
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Name lipase, family member N
Synonyms 2210418G03Rik, Lipl4
MMRRC Submission 038731-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0539 (G1)
Quality Score 136
Status Validated
Chromosome 19
Chromosomal Location 34044758-34062318 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 34062003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000148821]
AlphaFold Q3U4B4
Predicted Effect probably benign
Transcript: ENSMUST00000025682
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148821
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (107/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730480H06Rik T A 5: 48,536,692 (GRCm39) H129Q probably damaging Het
Abca14 G A 7: 119,807,020 (GRCm39) R22Q probably damaging Het
Abcg5 T A 17: 84,976,503 (GRCm39) M445L probably benign Het
Abhd3 T A 18: 10,645,208 (GRCm39) N357I possibly damaging Het
Adamts5 C T 16: 85,665,580 (GRCm39) G574S probably damaging Het
Adgrg5 T A 8: 95,665,260 (GRCm39) N389K probably damaging Het
Ankk1 A G 9: 49,329,330 (GRCm39) V80A probably benign Het
Arhgap20 A G 9: 51,761,455 (GRCm39) Q1066R probably benign Het
Arhgap21 T A 2: 20,919,610 (GRCm39) K32* probably null Het
AW209491 T C 13: 14,812,317 (GRCm39) F390S probably damaging Het
Axl A T 7: 25,478,142 (GRCm39) probably benign Het
Bri3bp A G 5: 125,531,603 (GRCm39) Y183C probably damaging Het
Cad T C 5: 31,232,801 (GRCm39) probably benign Het
Capns2 A G 8: 93,628,360 (GRCm39) Q83R possibly damaging Het
Ccdc180 G T 4: 45,922,010 (GRCm39) R1028L probably damaging Het
Cdh19 C A 1: 110,852,892 (GRCm39) V348F possibly damaging Het
Chrm2 T C 6: 36,500,641 (GRCm39) V166A possibly damaging Het
Clmp A G 9: 40,693,782 (GRCm39) Y333C probably benign Het
Cntn3 A G 6: 102,254,178 (GRCm39) probably null Het
Copz1 A G 15: 103,199,792 (GRCm39) Y69C probably damaging Het
Crybg1 T C 10: 43,874,894 (GRCm39) D738G probably benign Het
Ctnna2 T A 6: 76,950,882 (GRCm39) I165F probably damaging Het
Dcaf7 T G 11: 105,942,652 (GRCm39) S200A probably damaging Het
Deup1 T A 9: 15,493,893 (GRCm39) R416S possibly damaging Het
Dmxl1 T A 18: 49,990,497 (GRCm39) probably benign Het
Dnaaf11 A T 15: 66,319,455 (GRCm39) V305D probably damaging Het
Dnase2b A T 3: 146,294,910 (GRCm39) probably benign Het
Dst C T 1: 34,228,200 (GRCm39) P1606L probably damaging Het
Eef2 C CN 10: 81,014,602 (GRCm39) probably null Het
Ephb2 T C 4: 136,383,287 (GRCm39) Y931C probably damaging Het
Fam83h T C 15: 75,875,076 (GRCm39) S754G possibly damaging Het
Fibp T A 19: 5,513,216 (GRCm39) V177D probably damaging Het
Gfpt2 T C 11: 49,723,725 (GRCm39) I571T probably damaging Het
Grm7 T G 6: 111,336,055 (GRCm39) probably benign Het
Gsdma3 A G 11: 98,526,745 (GRCm39) Y335C probably damaging Het
H2-T23 A T 17: 36,343,033 (GRCm39) probably benign Het
H4c3 A G 13: 23,882,131 (GRCm39) F101S probably damaging Het
Hydin A G 8: 111,249,704 (GRCm39) I2216V probably benign Het
Ipo8 A G 6: 148,719,606 (GRCm39) M113T probably benign Het
Kdm6a A G X: 18,128,664 (GRCm39) E1045G probably damaging Het
Kyat1 C T 2: 30,078,229 (GRCm39) E117K probably damaging Het
Lin7b A G 7: 45,019,326 (GRCm39) probably benign Het
Lrfn2 C A 17: 49,378,072 (GRCm39) N384K probably damaging Het
Map1b T C 13: 99,570,526 (GRCm39) K732E unknown Het
Mpl A G 4: 118,300,705 (GRCm39) M541T possibly damaging Het
Mprip T C 11: 59,631,943 (GRCm39) probably benign Het
Mrc1 T C 2: 14,274,937 (GRCm39) probably benign Het
Ms4a13 T C 19: 11,149,235 (GRCm39) probably benign Het
Myo18b G T 5: 112,871,734 (GRCm39) R2116S probably damaging Het
Nav2 A G 7: 49,111,686 (GRCm39) T731A probably damaging Het
Ncoa6 G T 2: 155,257,617 (GRCm39) A642D probably benign Het
Ndufs7 T A 10: 80,090,665 (GRCm39) probably benign Het
Nfkbiz G A 16: 55,638,242 (GRCm39) T406M probably benign Het
Nr4a1 A G 15: 101,168,765 (GRCm39) E267G probably damaging Het
Nrxn2 T G 19: 6,543,434 (GRCm39) F1103V probably damaging Het
Or10ab4 C T 7: 107,655,029 (GRCm39) T280I probably damaging Het
Or10d3 A T 9: 39,461,593 (GRCm39) D191E probably damaging Het
Or1e22 T C 11: 73,376,889 (GRCm39) T254A probably benign Het
Or5a3 C T 19: 12,400,173 (GRCm39) L167F probably damaging Het
Or5g27 T A 2: 85,410,119 (GRCm39) C179S probably damaging Het
Or5m11 G T 2: 85,782,353 (GRCm39) M315I probably benign Het
Or8u9 A T 2: 86,001,387 (GRCm39) M258K probably damaging Het
Phf1 A G 17: 27,153,432 (GRCm39) probably null Het
Pip C T 6: 41,826,819 (GRCm39) Q53* probably null Het
Ppp2ca T C 11: 52,008,989 (GRCm39) probably null Het
Prl2c5 A G 13: 13,363,906 (GRCm39) probably null Het
Psph T A 5: 129,843,641 (GRCm39) probably benign Het
Ptch1 C T 13: 63,691,294 (GRCm39) probably benign Het
Ptprs C T 17: 56,765,255 (GRCm39) V10M probably damaging Het
Rarg T C 15: 102,147,312 (GRCm39) R358G probably damaging Het
Rbl2 T C 8: 91,839,133 (GRCm39) probably benign Het
Robo2 A T 16: 73,782,462 (GRCm39) probably benign Het
Scin A T 12: 40,131,765 (GRCm39) D256E possibly damaging Het
Scn8a T C 15: 100,914,449 (GRCm39) Y1152H probably damaging Het
Sh2b2 T G 5: 136,254,155 (GRCm39) probably benign Het
Slc13a2 G A 11: 78,289,964 (GRCm39) P450L probably damaging Het
Slc2a12 A G 10: 22,568,129 (GRCm39) I519V probably benign Het
Slc30a9 C T 5: 67,491,953 (GRCm39) T260M probably damaging Het
Slc9a7 A T X: 20,069,001 (GRCm39) F184Y probably damaging Het
Smc2 G T 4: 52,458,558 (GRCm39) K466N probably benign Het
Snx16 T C 3: 10,491,278 (GRCm39) E209G probably damaging Het
Sp3 A T 2: 72,800,876 (GRCm39) I423N possibly damaging Het
Ssh2 G T 11: 77,345,620 (GRCm39) V1202F probably benign Het
Stam2 A T 2: 52,593,268 (GRCm39) probably benign Het
Stox2 T C 8: 47,647,070 (GRCm39) Y194C probably damaging Het
Sult3a1 A G 10: 33,742,519 (GRCm39) T49A probably damaging Het
Supt3 A T 17: 45,314,018 (GRCm39) I136F possibly damaging Het
Syne2 A T 12: 76,070,895 (GRCm39) R103S possibly damaging Het
Synj2 T A 17: 6,047,163 (GRCm39) M1K probably null Het
Tas2r110 T C 6: 132,845,334 (GRCm39) S122P possibly damaging Het
Tln1 A G 4: 43,543,434 (GRCm39) probably null Het
Tmem117 A G 15: 94,612,793 (GRCm39) T110A possibly damaging Het
Tmem247 A G 17: 87,224,906 (GRCm39) D5G probably benign Het
Tmem39a T A 16: 38,411,337 (GRCm39) F363I probably benign Het
Tmem80 G A 7: 140,915,808 (GRCm39) A73T possibly damaging Het
Trpm4 C T 7: 44,954,896 (GRCm39) G901S probably damaging Het
Upk3bl T C 5: 136,092,840 (GRCm39) probably benign Het
Vmn1r120 A T 7: 20,787,397 (GRCm39) C105S probably damaging Het
Vmn1r69 A T 7: 10,314,874 (GRCm39) probably benign Het
Vmn2r95 T C 17: 18,672,362 (GRCm39) F700L probably damaging Het
Wdr70 G A 15: 7,915,118 (GRCm39) T550M possibly damaging Het
Zbtb22 A G 17: 34,137,118 (GRCm39) D421G possibly damaging Het
Zbtb45 G A 7: 12,740,260 (GRCm39) R452C probably damaging Het
Zfhx3 T C 8: 109,527,141 (GRCm39) Y1013H probably damaging Het
Zfp329 C T 7: 12,540,520 (GRCm39) probably null Het
Zfp532 T A 18: 65,756,837 (GRCm39) S257T probably benign Het
Zfp933 G A 4: 147,911,005 (GRCm39) T197I probably benign Het
Zgrf1 T A 3: 127,408,841 (GRCm39) N1649K probably damaging Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34,056,435 (GRCm39) missense probably benign 0.06
IGL01320:Lipn APN 19 34,062,040 (GRCm39) missense probably benign 0.07
IGL01827:Lipn APN 19 34,046,880 (GRCm39) missense probably damaging 1.00
IGL02252:Lipn APN 19 34,049,157 (GRCm39) missense probably benign 0.01
IGL02422:Lipn APN 19 34,046,063 (GRCm39) missense probably benign 0.00
R0081:Lipn UTSW 19 34,054,376 (GRCm39) missense probably benign 0.00
R0284:Lipn UTSW 19 34,058,106 (GRCm39) missense possibly damaging 0.87
R0749:Lipn UTSW 19 34,054,379 (GRCm39) missense probably damaging 1.00
R1170:Lipn UTSW 19 34,049,158 (GRCm39) missense probably benign 0.23
R1528:Lipn UTSW 19 34,046,070 (GRCm39) missense probably damaging 0.96
R1621:Lipn UTSW 19 34,046,113 (GRCm39) missense probably benign
R1675:Lipn UTSW 19 34,058,110 (GRCm39) missense probably damaging 1.00
R1869:Lipn UTSW 19 34,058,139 (GRCm39) missense possibly damaging 0.93
R3236:Lipn UTSW 19 34,046,138 (GRCm39) missense probably benign 0.17
R3237:Lipn UTSW 19 34,046,138 (GRCm39) missense probably benign 0.17
R3832:Lipn UTSW 19 34,046,933 (GRCm39) critical splice donor site probably null
R3876:Lipn UTSW 19 34,046,828 (GRCm39) missense probably benign 0.00
R4084:Lipn UTSW 19 34,056,340 (GRCm39) missense probably benign 0.04
R4595:Lipn UTSW 19 34,058,750 (GRCm39) missense probably damaging 1.00
R5963:Lipn UTSW 19 34,058,700 (GRCm39) missense probably damaging 0.97
R6018:Lipn UTSW 19 34,054,335 (GRCm39) missense probably damaging 1.00
R6797:Lipn UTSW 19 34,058,160 (GRCm39) missense probably benign
R7090:Lipn UTSW 19 34,049,180 (GRCm39) missense possibly damaging 0.72
R7157:Lipn UTSW 19 34,054,390 (GRCm39) nonsense probably null
R7458:Lipn UTSW 19 34,049,242 (GRCm39) missense probably benign 0.10
R8824:Lipn UTSW 19 34,062,116 (GRCm39) missense probably benign 0.04
R8894:Lipn UTSW 19 34,062,248 (GRCm39) makesense probably null
R8933:Lipn UTSW 19 34,046,880 (GRCm39) missense probably damaging 0.98
R9054:Lipn UTSW 19 34,054,376 (GRCm39) missense possibly damaging 0.56
R9117:Lipn UTSW 19 34,046,041 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTCTAACGCACAGCTTTACCT -3'
(R):5'- GCCCCAGACAAAATCAAAATGGTTCC -3'

Sequencing Primer
(F):5'- cattctcactcaaaccaccac -3'
(R):5'- TGGTTCCAATCTGGAAATTGC -3'
Posted On 2013-06-12