Mutagenetix > Incidental Mutations

Incidental Mutation 'R0540:Sohlh2'

49782

Institutional Source

Beutler Lab

Gene Symbol

Sohlh2

Ensembl Gene

ENSMUSG00000027794

Gene Name

spermatogenesis and oogenesis specific basic helix-loop-helix 2

Synonyms

4933406N12Rik

MMRRC Submission

038732-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.589) question?

Stock #

R0540 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55182028-55209957 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 55207683 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Tyrosine at position 363 (S363Y)

Ref Sequence

ENSEMBL: ENSMUSP00000029369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029369]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029369
AA Change: S363Y

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000029369
Gene: ENSMUSG00000027794
AA Change: S363Y

Domain	Start	End	E-Value	Type
HLH	206	257	4.2e-8	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	449	461	N/A	INTRINSIC

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.8%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents naturally occurring read-through transcription between the neighboring C13orf38 (chromosome 13 open reading frame 38) and SOHLH2 (spermatogenesis and oogenesis specific basic helix-loop-helix 2) genes. The read-through transcript encodes a fusion protein that shares sequence identity with the products of each individual gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to female and male infertility due to defects in early oocyte and spermatogonial differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl2	A	G	3: 60,019,206	T199A	possibly damaging	Het
Als2cl	C	A	9: 110,895,784	Y775*	probably null	Het
Ankhd1	G	T	18: 36,640,280	V59F	probably damaging	Het
Ano4	T	A	10: 89,023,944	I395F	probably benign	Het
Apcdd1	A	G	18: 62,951,896	N388S	possibly damaging	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Armc2	T	A	10: 41,922,695	H706L	probably benign	Het
Arrb1	T	C	7: 99,588,196		probably null	Het
Atxn1	G	A	13: 45,557,530	S642L	probably damaging	Het
Bmp8a	A	G	4: 123,315,930	Y322H	probably damaging	Het
Btbd3	C	T	2: 138,283,816	R307W	possibly damaging	Het
C1galt1	T	C	6: 7,871,193	I343T	probably benign	Het
Capn2	A	T	1: 182,492,184	Y146*	probably null	Het
Ccdc42	C	T	11: 68,597,710	Q312*	probably null	Het
Cd209e	T	C	8: 3,851,265	K130E	probably benign	Het
Chd3	T	C	11: 69,344,358	D2054G	probably damaging	Het
Chrna1	T	C	2: 73,571,471	N161S	probably damaging	Het
Clp1	C	T	2: 84,725,591	A182T	possibly damaging	Het
Cpsf7	G	T	19: 10,533,318	E135*	probably null	Het
Csf2rb2	T	C	15: 78,287,908	Y325C	probably benign	Het
Cspg5	T	C	9: 110,247,392		probably null	Het
Ctnna2	T	C	6: 76,902,430	T824A	probably benign	Het
Cyp2b13	G	A	7: 26,081,711	V183I	probably benign	Het
D430041D05Rik	C	T	2: 104,233,445	R1354H	probably damaging	Het
Ddx24	A	G	12: 103,419,067	Y426H	possibly damaging	Het
Dexi	G	T	16: 10,542,562	Y43*	probably null	Het
Dlg1	G	A	16: 31,838,174	V596I	possibly damaging	Het
Dnah11	A	C	12: 118,082,511	W1731G	probably damaging	Het
Dnhd1	T	A	7: 105,720,788	N4473K	probably benign	Het
Dync2h1	A	C	9: 7,051,480	S3152A	probably benign	Het
Edn3	C	A	2: 174,760,974	P3Q	probably damaging	Het
Eif2a	G	A	3: 58,555,652		probably null	Het
Emb	G	A	13: 117,232,750	V56I	possibly damaging	Het
Enpp4	A	T	17: 44,099,495	C397S	probably damaging	Het
Exo5	A	G	4: 120,921,981	V229A	probably damaging	Het
Fga	G	A	3: 83,028,562	G32E	probably damaging	Het
Fkbpl	T	C	17: 34,645,359	F34L	probably benign	Het
Fsd2	T	A	7: 81,545,017	D466V	probably damaging	Het
Gcn1l1	T	C	5: 115,588,956	V624A	probably benign	Het
Git2	A	G	5: 114,748,274	F336L	probably damaging	Het
Greb1	T	A	12: 16,682,193	Y1589F	probably damaging	Het
H2-K1	G	T	17: 33,999,500	D127E	probably damaging	Het
Ints8	A	G	4: 11,252,926	V52A	possibly damaging	Het
Kifc1	G	A	17: 33,886,647	T62I	probably damaging	Het
Klhl6	C	A	16: 19,957,014	D265Y	possibly damaging	Het
Kmt5a	T	A	5: 124,451,310	N190K	probably damaging	Het
Lce6a	A	T	3: 92,620,328	H57Q	probably benign	Het
Lipo3	A	T	19: 33,559,567	I251K	possibly damaging	Het
Lnpep	A	T	17: 17,538,554	F843I	probably damaging	Het
Lrrc45	C	T	11: 120,715,162	R99*	probably null	Het
Lrrtm1	C	A	6: 77,244,628	A356E	probably damaging	Het
Map3k1	A	C	13: 111,763,510	H493Q	probably benign	Het
Mcm4	A	T	16: 15,632,115		probably null	Het
Mkl2	A	G	16: 13,381,601	E106G	probably damaging	Het
Mllt3	G	A	4: 87,841,044	P256S	possibly damaging	Het
Myo7a	T	A	7: 98,071,946	T1271S	probably damaging	Het
Ncan	C	A	8: 70,115,159	R101L	possibly damaging	Het
Ndufaf7	A	G	17: 78,946,456	D361G	probably benign	Het
Neurod6	C	T	6: 55,679,587	A22T	probably benign	Het
Nexn	T	A	3: 152,248,242	K192*	probably null	Het
Nipsnap2	A	T	5: 129,754,845	Y234F	probably damaging	Het
Nlrp10	T	C	7: 108,924,285	K663E	probably benign	Het
Nprl2	A	T	9: 107,545,298	Y329F	possibly damaging	Het
Nr2f2	C	A	7: 70,354,712	R264L	probably damaging	Het
Nsun7	A	T	5: 66,283,634	K366I	probably damaging	Het
Nup35	T	A	2: 80,642,640	M19K	probably benign	Het
Olfr1364	T	A	13: 21,573,778	Y226F	probably benign	Het
Olfr1378	C	A	11: 50,969,843	A275D	possibly damaging	Het
Olfr17	T	A	7: 107,097,726	I87K	probably benign	Het
Olfr266	A	T	3: 106,822,513	F15L	probably damaging	Het
Olfr312	T	A	11: 58,831,972	S273T	probably damaging	Het
Olfr470	A	G	7: 107,845,569	S55P	probably damaging	Het
Olfr56	C	G	11: 49,134,722	H177D	probably damaging	Het
Patl2	T	C	2: 122,126,669	Y128C	probably benign	Het
Pcdhac2	A	G	18: 37,145,889	I641V	probably benign	Het
Peli3	T	C	19: 4,941,911	M1V	probably null	Het
Pex16	T	A	2: 92,375,637	L25*	probably null	Het
Plekhn1	C	A	4: 156,222,747	A449S	possibly damaging	Het
Pot1b	A	T	17: 55,665,765	I469N	probably damaging	Het
Prdx6	A	C	1: 161,251,103	L5W	probably damaging	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Prss38	T	C	11: 59,375,543	S30G	possibly damaging	Het
Rgs6	C	A	12: 83,059,804	Y151*	probably null	Het
Ripk4	A	C	16: 97,744,175	L361R	probably damaging	Het
Serpinb3d	C	T	1: 107,079,232	D249N	probably benign	Het
Skint10	A	T	4: 112,773,027		probably null	Het
Smg7	A	T	1: 152,855,962	N349K	probably benign	Het
Srsf10	A	G	4: 135,863,868	T210A	possibly damaging	Het
Synpo2l	A	T	14: 20,660,680	M624K	probably damaging	Het
Thsd7a	T	A	6: 12,331,542		probably null	Het
Tnc	A	T	4: 64,020,455	V49E	probably damaging	Het
Tnik	A	C	3: 28,650,159	K989T	probably damaging	Het
Tnxb	T	A	17: 34,671,918	Y412N	probably damaging	Het
Trmt44	A	G	5: 35,568,759		probably null	Het
Tsc2	A	T	17: 24,621,712	V391E	probably damaging	Het
Ttll5	T	C	12: 85,933,676		probably null	Het
Usp28	A	G	9: 49,024,060	I104V	probably benign	Het
Vmn1r64	A	G	7: 5,884,097	L149S	probably damaging	Het
Yme1l1	T	A	2: 23,192,515	M506K	possibly damaging	Het
Zfp280d	T	A	9: 72,307,965	F98I	probably damaging	Het
Zfp62	C	A	11: 49,215,400	T106K	probably benign	Het

Other mutations in Sohlh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Sohlh2	APN	3	55207815	missense	probably damaging	1.00
IGL00574:Sohlh2	APN	3	55204326	splice site	probably benign
IGL01434:Sohlh2	APN	3	55195161	missense	probably damaging	1.00
IGL02200:Sohlh2	APN	3	55190556	missense	probably damaging	1.00
R0362:Sohlh2	UTSW	3	55207742	missense	probably damaging	1.00
R0607:Sohlh2	UTSW	3	55207683	missense	probably damaging	0.99
R0732:Sohlh2	UTSW	3	55190373	critical splice donor site	probably null
R1878:Sohlh2	UTSW	3	55207643	missense	probably damaging	0.97
R2001:Sohlh2	UTSW	3	55192341	splice site	probably null
R2070:Sohlh2	UTSW	3	55207622	missense	probably benign	0.18
R2071:Sohlh2	UTSW	3	55207622	missense	probably benign	0.18
R4412:Sohlh2	UTSW	3	55197002	missense	probably damaging	1.00
R4413:Sohlh2	UTSW	3	55197002	missense	probably damaging	1.00
R4714:Sohlh2	UTSW	3	55190529	missense	probably benign	0.00
R5709:Sohlh2	UTSW	3	55192302	missense	probably benign	0.03
R5818:Sohlh2	UTSW	3	55190501	missense	probably damaging	1.00
R6173:Sohlh2	UTSW	3	55196998	missense	probably benign	0.26
R6822:Sohlh2	UTSW	3	55207686	missense	probably damaging	1.00
R6850:Sohlh2	UTSW	3	55192286	missense	probably benign	0.05
X0023:Sohlh2	UTSW	3	55196776	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TCCAATACGGTAGTCAGAGCCACAG -3'
(R):5'- TTGGGACCAGGGCATTAACAGC -3'

Sequencing Primer
(F):5'- TAGTCAGAGCCACAGAGGTG -3'
(R):5'- AGAAGTCTCTTACTCACTTACCAGG -3'

Posted On

2013-06-12