Mutagenetix > Incidental Mutations

Incidental Mutation 'R0540:Fga'

49785

Institutional Source

Beutler Lab

Gene Symbol

Fga

Ensembl Gene

ENSMUSG00000028001

Gene Name

fibrinogen alpha chain

Synonyms

ENSMUSG00000059807, Fib

MMRRC Submission

038732-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.363) question?

Stock #

R0540 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83026076-83033627 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 83028562 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 32 (G32E)

Ref Sequence

ENSEMBL: ENSMUSP00000133117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029630
AA Change: G32E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: G32E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	458	1.6e-33	PFAM
low complexity region	500	522	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166581
AA Change: G32E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: G32E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	457	9.3e-34	PFAM
low complexity region	500	522	N/A	INTRINSIC
FBG	550	786	1.43e-128	SMART

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.8%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl2	A	G	3: 60,019,206	T199A	possibly damaging	Het
Als2cl	C	A	9: 110,895,784	Y775*	probably null	Het
Ankhd1	G	T	18: 36,640,280	V59F	probably damaging	Het
Ano4	T	A	10: 89,023,944	I395F	probably benign	Het
Apcdd1	A	G	18: 62,951,896	N388S	possibly damaging	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Armc2	T	A	10: 41,922,695	H706L	probably benign	Het
Arrb1	T	C	7: 99,588,196		probably null	Het
Atxn1	G	A	13: 45,557,530	S642L	probably damaging	Het
Bmp8a	A	G	4: 123,315,930	Y322H	probably damaging	Het
Btbd3	C	T	2: 138,283,816	R307W	possibly damaging	Het
C1galt1	T	C	6: 7,871,193	I343T	probably benign	Het
Capn2	A	T	1: 182,492,184	Y146*	probably null	Het
Ccdc42	C	T	11: 68,597,710	Q312*	probably null	Het
Cd209e	T	C	8: 3,851,265	K130E	probably benign	Het
Chd3	T	C	11: 69,344,358	D2054G	probably damaging	Het
Chrna1	T	C	2: 73,571,471	N161S	probably damaging	Het
Clp1	C	T	2: 84,725,591	A182T	possibly damaging	Het
Cpsf7	G	T	19: 10,533,318	E135*	probably null	Het
Csf2rb2	T	C	15: 78,287,908	Y325C	probably benign	Het
Cspg5	T	C	9: 110,247,392		probably null	Het
Ctnna2	T	C	6: 76,902,430	T824A	probably benign	Het
Cyp2b13	G	A	7: 26,081,711	V183I	probably benign	Het
D430041D05Rik	C	T	2: 104,233,445	R1354H	probably damaging	Het
Ddx24	A	G	12: 103,419,067	Y426H	possibly damaging	Het
Dexi	G	T	16: 10,542,562	Y43*	probably null	Het
Dlg1	G	A	16: 31,838,174	V596I	possibly damaging	Het
Dnah11	A	C	12: 118,082,511	W1731G	probably damaging	Het
Dnhd1	T	A	7: 105,720,788	N4473K	probably benign	Het
Dync2h1	A	C	9: 7,051,480	S3152A	probably benign	Het
Edn3	C	A	2: 174,760,974	P3Q	probably damaging	Het
Eif2a	G	A	3: 58,555,652		probably null	Het
Emb	G	A	13: 117,232,750	V56I	possibly damaging	Het
Enpp4	A	T	17: 44,099,495	C397S	probably damaging	Het
Exo5	A	G	4: 120,921,981	V229A	probably damaging	Het
Fkbpl	T	C	17: 34,645,359	F34L	probably benign	Het
Fsd2	T	A	7: 81,545,017	D466V	probably damaging	Het
Gcn1l1	T	C	5: 115,588,956	V624A	probably benign	Het
Git2	A	G	5: 114,748,274	F336L	probably damaging	Het
Greb1	T	A	12: 16,682,193	Y1589F	probably damaging	Het
H2-K1	G	T	17: 33,999,500	D127E	probably damaging	Het
Ints8	A	G	4: 11,252,926	V52A	possibly damaging	Het
Kifc1	G	A	17: 33,886,647	T62I	probably damaging	Het
Klhl6	C	A	16: 19,957,014	D265Y	possibly damaging	Het
Kmt5a	T	A	5: 124,451,310	N190K	probably damaging	Het
Lce6a	A	T	3: 92,620,328	H57Q	probably benign	Het
Lipo3	A	T	19: 33,559,567	I251K	possibly damaging	Het
Lnpep	A	T	17: 17,538,554	F843I	probably damaging	Het
Lrrc45	C	T	11: 120,715,162	R99*	probably null	Het
Lrrtm1	C	A	6: 77,244,628	A356E	probably damaging	Het
Map3k1	A	C	13: 111,763,510	H493Q	probably benign	Het
Mcm4	A	T	16: 15,632,115		probably null	Het
Mkl2	A	G	16: 13,381,601	E106G	probably damaging	Het
Mllt3	G	A	4: 87,841,044	P256S	possibly damaging	Het
Myo7a	T	A	7: 98,071,946	T1271S	probably damaging	Het
Ncan	C	A	8: 70,115,159	R101L	possibly damaging	Het
Ndufaf7	A	G	17: 78,946,456	D361G	probably benign	Het
Neurod6	C	T	6: 55,679,587	A22T	probably benign	Het
Nexn	T	A	3: 152,248,242	K192*	probably null	Het
Nipsnap2	A	T	5: 129,754,845	Y234F	probably damaging	Het
Nlrp10	T	C	7: 108,924,285	K663E	probably benign	Het
Nprl2	A	T	9: 107,545,298	Y329F	possibly damaging	Het
Nr2f2	C	A	7: 70,354,712	R264L	probably damaging	Het
Nsun7	A	T	5: 66,283,634	K366I	probably damaging	Het
Nup35	T	A	2: 80,642,640	M19K	probably benign	Het
Olfr1364	T	A	13: 21,573,778	Y226F	probably benign	Het
Olfr1378	C	A	11: 50,969,843	A275D	possibly damaging	Het
Olfr17	T	A	7: 107,097,726	I87K	probably benign	Het
Olfr266	A	T	3: 106,822,513	F15L	probably damaging	Het
Olfr312	T	A	11: 58,831,972	S273T	probably damaging	Het
Olfr470	A	G	7: 107,845,569	S55P	probably damaging	Het
Olfr56	C	G	11: 49,134,722	H177D	probably damaging	Het
Patl2	T	C	2: 122,126,669	Y128C	probably benign	Het
Pcdhac2	A	G	18: 37,145,889	I641V	probably benign	Het
Peli3	T	C	19: 4,941,911	M1V	probably null	Het
Pex16	T	A	2: 92,375,637	L25*	probably null	Het
Plekhn1	C	A	4: 156,222,747	A449S	possibly damaging	Het
Pot1b	A	T	17: 55,665,765	I469N	probably damaging	Het
Prdx6	A	C	1: 161,251,103	L5W	probably damaging	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Prss38	T	C	11: 59,375,543	S30G	possibly damaging	Het
Rgs6	C	A	12: 83,059,804	Y151*	probably null	Het
Ripk4	A	C	16: 97,744,175	L361R	probably damaging	Het
Serpinb3d	C	T	1: 107,079,232	D249N	probably benign	Het
Skint10	A	T	4: 112,773,027		probably null	Het
Smg7	A	T	1: 152,855,962	N349K	probably benign	Het
Sohlh2	C	A	3: 55,207,683	S363Y	probably damaging	Het
Srsf10	A	G	4: 135,863,868	T210A	possibly damaging	Het
Synpo2l	A	T	14: 20,660,680	M624K	probably damaging	Het
Thsd7a	T	A	6: 12,331,542		probably null	Het
Tnc	A	T	4: 64,020,455	V49E	probably damaging	Het
Tnik	A	C	3: 28,650,159	K989T	probably damaging	Het
Tnxb	T	A	17: 34,671,918	Y412N	probably damaging	Het
Trmt44	A	G	5: 35,568,759		probably null	Het
Tsc2	A	T	17: 24,621,712	V391E	probably damaging	Het
Ttll5	T	C	12: 85,933,676		probably null	Het
Usp28	A	G	9: 49,024,060	I104V	probably benign	Het
Vmn1r64	A	G	7: 5,884,097	L149S	probably damaging	Het
Yme1l1	T	A	2: 23,192,515	M506K	possibly damaging	Het
Zfp280d	T	A	9: 72,307,965	F98I	probably damaging	Het
Zfp62	C	A	11: 49,215,400	T106K	probably benign	Het

Other mutations in Fga

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Fga	APN	3	83031674	missense	probably damaging	1.00
IGL00478:Fga	APN	3	83028644	missense	probably benign	0.00
IGL00587:Fga	APN	3	83030289	missense	possibly damaging	0.62
IGL01289:Fga	APN	3	83031245	missense	possibly damaging	0.85
IGL01323:Fga	APN	3	83030211	missense	probably damaging	0.99
IGL01369:Fga	APN	3	83030200	missense	probably benign	0.00
IGL01409:Fga	APN	3	83032752	missense	probably damaging	1.00
IGL01541:Fga	APN	3	83032707	missense	probably damaging	1.00
IGL01633:Fga	APN	3	83030299	missense	possibly damaging	0.89
IGL01966:Fga	APN	3	83029154	missense	probably damaging	0.97
IGL02651:Fga	APN	3	83028534	missense	probably benign	0.00
IGL02822:Fga	APN	3	83031482	missense	probably damaging	1.00
IGL03003:Fga	APN	3	83032730	missense	probably damaging	1.00
R0336:Fga	UTSW	3	83030857	missense	probably damaging	1.00
R0607:Fga	UTSW	3	83028562	missense	probably damaging	1.00
R1471:Fga	UTSW	3	83028618	missense	probably benign	0.16
R1517:Fga	UTSW	3	83031838	missense	probably benign	0.00
R1817:Fga	UTSW	3	83031775	missense	probably benign	0.00
R1874:Fga	UTSW	3	83032721	missense	probably damaging	1.00
R2014:Fga	UTSW	3	83032757	missense	probably damaging	0.99
R2267:Fga	UTSW	3	83032950	missense	probably damaging	1.00
R2332:Fga	UTSW	3	83031397	missense	probably damaging	1.00
R2420:Fga	UTSW	3	83033154	missense	possibly damaging	0.53
R2443:Fga	UTSW	3	83028541	missense	probably benign	0.03
R3978:Fga	UTSW	3	83030183	critical splice acceptor site	probably null
R4597:Fga	UTSW	3	83031235	nonsense	probably null
R4644:Fga	UTSW	3	83030266	missense	possibly damaging	0.81
R4760:Fga	UTSW	3	83031514	missense	probably benign
R4867:Fga	UTSW	3	83028644	missense	probably benign	0.00
R5449:Fga	UTSW	3	83030862	frame shift	probably null
R5507:Fga	UTSW	3	83033336	missense	probably damaging	1.00
R5712:Fga	UTSW	3	83033133	missense	possibly damaging	0.70
R6853:Fga	UTSW	3	83030912	missense	probably damaging	1.00
R6865:Fga	UTSW	3	83031541	missense	probably damaging	1.00
R7163:Fga	UTSW	3	83026264	missense	probably benign	0.04
R7724:Fga	UTSW	3	83029125	missense	probably damaging	0.99
R8153:Fga	UTSW	3	83030857	missense	probably damaging	1.00
R8506:Fga	UTSW	3	83033316	missense	probably damaging	1.00
R8511:Fga	UTSW	3	83031757	nonsense	probably null
X0062:Fga	UTSW	3	83030271	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- TAAGAAACTGGCAGCCTGTGGAAGC -3'
(R):5'- TGTGTAGTCCCACTACTCAGGCATC -3'

Sequencing Primer
(F):5'- GGGCTAGTGAGCATGACAAA -3'
(R):5'- CCGATGTAACTAGACAATGTCCTTC -3'

Posted On

2013-06-12