Incidental Mutation 'R0540:Ints8'
ID49790
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Nameintegrator complex subunit 8
Synonyms2810013E07Rik, D130008D20Rik
MMRRC Submission 038732-MU
Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0540 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location11199158-11254258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11252926 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 52 (V52A)
Ref Sequence ENSEMBL: ENSMUSP00000103954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]
Predicted Effect probably benign
Transcript: ENSMUST00000044616
AA Change: V52A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: V52A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108318
AA Change: V52A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: V52A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108319
AA Change: V52A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: V52A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A G 3: 60,019,206 T199A possibly damaging Het
Als2cl C A 9: 110,895,784 Y775* probably null Het
Ankhd1 G T 18: 36,640,280 V59F probably damaging Het
Ano4 T A 10: 89,023,944 I395F probably benign Het
Apcdd1 A G 18: 62,951,896 N388S possibly damaging Het
Arl9 A G 5: 77,007,271 Y83C possibly damaging Het
Armc2 T A 10: 41,922,695 H706L probably benign Het
Arrb1 T C 7: 99,588,196 probably null Het
Atxn1 G A 13: 45,557,530 S642L probably damaging Het
Bmp8a A G 4: 123,315,930 Y322H probably damaging Het
Btbd3 C T 2: 138,283,816 R307W possibly damaging Het
C1galt1 T C 6: 7,871,193 I343T probably benign Het
Capn2 A T 1: 182,492,184 Y146* probably null Het
Ccdc42 C T 11: 68,597,710 Q312* probably null Het
Cd209e T C 8: 3,851,265 K130E probably benign Het
Chd3 T C 11: 69,344,358 D2054G probably damaging Het
Chrna1 T C 2: 73,571,471 N161S probably damaging Het
Clp1 C T 2: 84,725,591 A182T possibly damaging Het
Cpsf7 G T 19: 10,533,318 E135* probably null Het
Csf2rb2 T C 15: 78,287,908 Y325C probably benign Het
Cspg5 T C 9: 110,247,392 probably null Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cyp2b13 G A 7: 26,081,711 V183I probably benign Het
D430041D05Rik C T 2: 104,233,445 R1354H probably damaging Het
Ddx24 A G 12: 103,419,067 Y426H possibly damaging Het
Dexi G T 16: 10,542,562 Y43* probably null Het
Dlg1 G A 16: 31,838,174 V596I possibly damaging Het
Dnah11 A C 12: 118,082,511 W1731G probably damaging Het
Dnhd1 T A 7: 105,720,788 N4473K probably benign Het
Dync2h1 A C 9: 7,051,480 S3152A probably benign Het
Edn3 C A 2: 174,760,974 P3Q probably damaging Het
Eif2a G A 3: 58,555,652 probably null Het
Emb G A 13: 117,232,750 V56I possibly damaging Het
Enpp4 A T 17: 44,099,495 C397S probably damaging Het
Exo5 A G 4: 120,921,981 V229A probably damaging Het
Fga G A 3: 83,028,562 G32E probably damaging Het
Fkbpl T C 17: 34,645,359 F34L probably benign Het
Fsd2 T A 7: 81,545,017 D466V probably damaging Het
Gcn1l1 T C 5: 115,588,956 V624A probably benign Het
Git2 A G 5: 114,748,274 F336L probably damaging Het
Greb1 T A 12: 16,682,193 Y1589F probably damaging Het
H2-K1 G T 17: 33,999,500 D127E probably damaging Het
Kifc1 G A 17: 33,886,647 T62I probably damaging Het
Klhl6 C A 16: 19,957,014 D265Y possibly damaging Het
Kmt5a T A 5: 124,451,310 N190K probably damaging Het
Lce6a A T 3: 92,620,328 H57Q probably benign Het
Lipo3 A T 19: 33,559,567 I251K possibly damaging Het
Lnpep A T 17: 17,538,554 F843I probably damaging Het
Lrrc45 C T 11: 120,715,162 R99* probably null Het
Lrrtm1 C A 6: 77,244,628 A356E probably damaging Het
Map3k1 A C 13: 111,763,510 H493Q probably benign Het
Mcm4 A T 16: 15,632,115 probably null Het
Mkl2 A G 16: 13,381,601 E106G probably damaging Het
Mllt3 G A 4: 87,841,044 P256S possibly damaging Het
Myo7a T A 7: 98,071,946 T1271S probably damaging Het
Ncan C A 8: 70,115,159 R101L possibly damaging Het
Ndufaf7 A G 17: 78,946,456 D361G probably benign Het
Neurod6 C T 6: 55,679,587 A22T probably benign Het
Nexn T A 3: 152,248,242 K192* probably null Het
Nipsnap2 A T 5: 129,754,845 Y234F probably damaging Het
Nlrp10 T C 7: 108,924,285 K663E probably benign Het
Nprl2 A T 9: 107,545,298 Y329F possibly damaging Het
Nr2f2 C A 7: 70,354,712 R264L probably damaging Het
Nsun7 A T 5: 66,283,634 K366I probably damaging Het
Nup35 T A 2: 80,642,640 M19K probably benign Het
Olfr1364 T A 13: 21,573,778 Y226F probably benign Het
Olfr1378 C A 11: 50,969,843 A275D possibly damaging Het
Olfr17 T A 7: 107,097,726 I87K probably benign Het
Olfr266 A T 3: 106,822,513 F15L probably damaging Het
Olfr312 T A 11: 58,831,972 S273T probably damaging Het
Olfr470 A G 7: 107,845,569 S55P probably damaging Het
Olfr56 C G 11: 49,134,722 H177D probably damaging Het
Patl2 T C 2: 122,126,669 Y128C probably benign Het
Pcdhac2 A G 18: 37,145,889 I641V probably benign Het
Peli3 T C 19: 4,941,911 M1V probably null Het
Pex16 T A 2: 92,375,637 L25* probably null Het
Plekhn1 C A 4: 156,222,747 A449S possibly damaging Het
Pot1b A T 17: 55,665,765 I469N probably damaging Het
Prdx6 A C 1: 161,251,103 L5W probably damaging Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Prss38 T C 11: 59,375,543 S30G possibly damaging Het
Rgs6 C A 12: 83,059,804 Y151* probably null Het
Ripk4 A C 16: 97,744,175 L361R probably damaging Het
Serpinb3d C T 1: 107,079,232 D249N probably benign Het
Skint10 A T 4: 112,773,027 probably null Het
Smg7 A T 1: 152,855,962 N349K probably benign Het
Sohlh2 C A 3: 55,207,683 S363Y probably damaging Het
Srsf10 A G 4: 135,863,868 T210A possibly damaging Het
Synpo2l A T 14: 20,660,680 M624K probably damaging Het
Thsd7a T A 6: 12,331,542 probably null Het
Tnc A T 4: 64,020,455 V49E probably damaging Het
Tnik A C 3: 28,650,159 K989T probably damaging Het
Tnxb T A 17: 34,671,918 Y412N probably damaging Het
Trmt44 A G 5: 35,568,759 probably null Het
Tsc2 A T 17: 24,621,712 V391E probably damaging Het
Ttll5 T C 12: 85,933,676 probably null Het
Usp28 A G 9: 49,024,060 I104V probably benign Het
Vmn1r64 A G 7: 5,884,097 L149S probably damaging Het
Yme1l1 T A 2: 23,192,515 M506K possibly damaging Het
Zfp280d T A 9: 72,307,965 F98I probably damaging Het
Zfp62 C A 11: 49,215,400 T106K probably benign Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11218679 splice site probably benign
IGL01925:Ints8 APN 4 11235617 splice site probably benign
IGL02195:Ints8 APN 4 11221222 missense probably damaging 1.00
IGL02215:Ints8 APN 4 11209244 missense probably damaging 1.00
IGL02429:Ints8 APN 4 11231720 missense probably damaging 1.00
IGL02484:Ints8 APN 4 11208834 nonsense probably null
IGL02558:Ints8 APN 4 11218771 missense probably damaging 1.00
IGL02725:Ints8 APN 4 11239406 missense probably benign 0.01
IGL02742:Ints8 APN 4 11241627 missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11245896 missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11235565 missense probably damaging 1.00
IGL03171:Ints8 APN 4 11231702 missense probably benign 0.01
IGL03335:Ints8 APN 4 11216460 missense probably damaging 1.00
G1Funyon:Ints8 UTSW 4 11246120 missense probably damaging 1.00
P0026:Ints8 UTSW 4 11225788 nonsense probably null
R0054:Ints8 UTSW 4 11204595 utr 3 prime probably benign
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0184:Ints8 UTSW 4 11218637 missense probably benign 0.03
R0299:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0499:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0657:Ints8 UTSW 4 11246097 missense probably benign 0.04
R1232:Ints8 UTSW 4 11234587 missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11221204 missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11239461 missense probably benign 0.22
R1503:Ints8 UTSW 4 11245842 missense probably damaging 0.97
R1587:Ints8 UTSW 4 11245722 critical splice donor site probably null
R1701:Ints8 UTSW 4 11231656 missense probably damaging 1.00
R1721:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1757:Ints8 UTSW 4 11254109 start codon destroyed probably null 0.99
R1777:Ints8 UTSW 4 11225600 critical splice donor site probably null
R1867:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1868:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1952:Ints8 UTSW 4 11221150 missense probably benign 0.21
R2084:Ints8 UTSW 4 11230377 missense probably benign 0.31
R2108:Ints8 UTSW 4 11235552 missense probably damaging 0.99
R2202:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11225725 missense probably benign 0.29
R2504:Ints8 UTSW 4 11241642 missense probably benign 0.03
R3824:Ints8 UTSW 4 11225621 nonsense probably null
R4664:Ints8 UTSW 4 11227152 missense probably benign 0.04
R4703:Ints8 UTSW 4 11223785 missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11230367 nonsense probably null
R5206:Ints8 UTSW 4 11216477 missense possibly damaging 0.65
R5262:Ints8 UTSW 4 11211916 missense probably damaging 1.00
R5505:Ints8 UTSW 4 11221143 missense probably benign 0.18
R5513:Ints8 UTSW 4 11248303 missense possibly damaging 0.79
R5750:Ints8 UTSW 4 11241654 missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11223813 missense probably damaging 1.00
R6007:Ints8 UTSW 4 11208845 missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11252891 missense probably damaging 1.00
R6466:Ints8 UTSW 4 11252878 missense probably damaging 0.99
R6709:Ints8 UTSW 4 11221117 missense possibly damaging 0.65
R6986:Ints8 UTSW 4 11204474 missense probably damaging 1.00
R6998:Ints8 UTSW 4 11204537 missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11204574 missense possibly damaging 0.82
R7221:Ints8 UTSW 4 11225613 missense probably benign 0.01
R7772:Ints8 UTSW 4 11227190 missense probably damaging 0.97
R7872:Ints8 UTSW 4 11254062 missense probably benign 0.00
R7953:Ints8 UTSW 4 11227128 missense probably benign
R8184:Ints8 UTSW 4 11204534 missense probably damaging 1.00
R8301:Ints8 UTSW 4 11246120 missense probably damaging 1.00
R8708:Ints8 UTSW 4 11208824 critical splice donor site probably null
R8868:Ints8 UTSW 4 11230488 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGACTTTCTCATGTTACCACGCCTG -3'
(R):5'- TAAGCTGGCAAACGCCGATCTG -3'

Sequencing Primer
(F):5'- accctgctgtcctgtctg -3'
(R):5'- CACACCTCCAGATGTTTCGT -3'
Posted On2013-06-12