Incidental Mutation 'R0540:Nipsnap2'
Institutional Source Beutler Lab
Gene Symbol Nipsnap2
Ensembl Gene ENSMUSG00000029432
Gene Namenipsnap homolog 2
SynonymsGbas, Nipsnap2
MMRRC Submission 038732-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0540 (G1)
Quality Score225
Status Not validated
Chromosomal Location129725063-129758327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129754845 bp
Amino Acid Change Tyrosine to Phenylalanine at position 234 (Y234F)
Ref Sequence ENSEMBL: ENSMUSP00000141131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086046] [ENSMUST00000124342] [ENSMUST00000186265] [ENSMUST00000195946]
Predicted Effect probably damaging
Transcript: ENSMUST00000086046
AA Change: Y234F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083211
Gene: ENSMUSG00000029432
AA Change: Y234F

low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.6e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124342
AA Change: Y234F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117705
Gene: ENSMUSG00000029432
AA Change: Y234F

low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137604
Predicted Effect probably damaging
Transcript: ENSMUST00000186265
AA Change: Y234F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141131
Gene: ENSMUSG00000029432
AA Change: Y234F

low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195946
SMART Domains Protein: ENSMUSP00000142916
Gene: ENSMUSG00000029432

low complexity region 2 17 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. The encoded protein is localized to mitochondria and plays a role in oxidative phosphorylation. A pseudogene of this gene is located on the long arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A G 3: 60,019,206 T199A possibly damaging Het
Als2cl C A 9: 110,895,784 Y775* probably null Het
Ankhd1 G T 18: 36,640,280 V59F probably damaging Het
Ano4 T A 10: 89,023,944 I395F probably benign Het
Apcdd1 A G 18: 62,951,896 N388S possibly damaging Het
Arl9 A G 5: 77,007,271 Y83C possibly damaging Het
Armc2 T A 10: 41,922,695 H706L probably benign Het
Arrb1 T C 7: 99,588,196 probably null Het
Atxn1 G A 13: 45,557,530 S642L probably damaging Het
Bmp8a A G 4: 123,315,930 Y322H probably damaging Het
Btbd3 C T 2: 138,283,816 R307W possibly damaging Het
C1galt1 T C 6: 7,871,193 I343T probably benign Het
Capn2 A T 1: 182,492,184 Y146* probably null Het
Ccdc42 C T 11: 68,597,710 Q312* probably null Het
Cd209e T C 8: 3,851,265 K130E probably benign Het
Chd3 T C 11: 69,344,358 D2054G probably damaging Het
Chrna1 T C 2: 73,571,471 N161S probably damaging Het
Clp1 C T 2: 84,725,591 A182T possibly damaging Het
Cpsf7 G T 19: 10,533,318 E135* probably null Het
Csf2rb2 T C 15: 78,287,908 Y325C probably benign Het
Cspg5 T C 9: 110,247,392 probably null Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cyp2b13 G A 7: 26,081,711 V183I probably benign Het
D430041D05Rik C T 2: 104,233,445 R1354H probably damaging Het
Ddx24 A G 12: 103,419,067 Y426H possibly damaging Het
Dexi G T 16: 10,542,562 Y43* probably null Het
Dlg1 G A 16: 31,838,174 V596I possibly damaging Het
Dnah11 A C 12: 118,082,511 W1731G probably damaging Het
Dnhd1 T A 7: 105,720,788 N4473K probably benign Het
Dync2h1 A C 9: 7,051,480 S3152A probably benign Het
Edn3 C A 2: 174,760,974 P3Q probably damaging Het
Eif2a G A 3: 58,555,652 probably null Het
Emb G A 13: 117,232,750 V56I possibly damaging Het
Enpp4 A T 17: 44,099,495 C397S probably damaging Het
Exo5 A G 4: 120,921,981 V229A probably damaging Het
Fga G A 3: 83,028,562 G32E probably damaging Het
Fkbpl T C 17: 34,645,359 F34L probably benign Het
Fsd2 T A 7: 81,545,017 D466V probably damaging Het
Gcn1l1 T C 5: 115,588,956 V624A probably benign Het
Git2 A G 5: 114,748,274 F336L probably damaging Het
Greb1 T A 12: 16,682,193 Y1589F probably damaging Het
H2-K1 G T 17: 33,999,500 D127E probably damaging Het
Ints8 A G 4: 11,252,926 V52A possibly damaging Het
Kifc1 G A 17: 33,886,647 T62I probably damaging Het
Klhl6 C A 16: 19,957,014 D265Y possibly damaging Het
Kmt5a T A 5: 124,451,310 N190K probably damaging Het
Lce6a A T 3: 92,620,328 H57Q probably benign Het
Lipo3 A T 19: 33,559,567 I251K possibly damaging Het
Lnpep A T 17: 17,538,554 F843I probably damaging Het
Lrrc45 C T 11: 120,715,162 R99* probably null Het
Lrrtm1 C A 6: 77,244,628 A356E probably damaging Het
Map3k1 A C 13: 111,763,510 H493Q probably benign Het
Mcm4 A T 16: 15,632,115 probably null Het
Mkl2 A G 16: 13,381,601 E106G probably damaging Het
Mllt3 G A 4: 87,841,044 P256S possibly damaging Het
Myo7a T A 7: 98,071,946 T1271S probably damaging Het
Ncan C A 8: 70,115,159 R101L possibly damaging Het
Ndufaf7 A G 17: 78,946,456 D361G probably benign Het
Neurod6 C T 6: 55,679,587 A22T probably benign Het
Nexn T A 3: 152,248,242 K192* probably null Het
Nlrp10 T C 7: 108,924,285 K663E probably benign Het
Nprl2 A T 9: 107,545,298 Y329F possibly damaging Het
Nr2f2 C A 7: 70,354,712 R264L probably damaging Het
Nsun7 A T 5: 66,283,634 K366I probably damaging Het
Nup35 T A 2: 80,642,640 M19K probably benign Het
Olfr1364 T A 13: 21,573,778 Y226F probably benign Het
Olfr1378 C A 11: 50,969,843 A275D possibly damaging Het
Olfr17 T A 7: 107,097,726 I87K probably benign Het
Olfr266 A T 3: 106,822,513 F15L probably damaging Het
Olfr312 T A 11: 58,831,972 S273T probably damaging Het
Olfr470 A G 7: 107,845,569 S55P probably damaging Het
Olfr56 C G 11: 49,134,722 H177D probably damaging Het
Patl2 T C 2: 122,126,669 Y128C probably benign Het
Pcdhac2 A G 18: 37,145,889 I641V probably benign Het
Peli3 T C 19: 4,941,911 M1V probably null Het
Pex16 T A 2: 92,375,637 L25* probably null Het
Plekhn1 C A 4: 156,222,747 A449S possibly damaging Het
Pot1b A T 17: 55,665,765 I469N probably damaging Het
Prdx6 A C 1: 161,251,103 L5W probably damaging Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Prss38 T C 11: 59,375,543 S30G possibly damaging Het
Rgs6 C A 12: 83,059,804 Y151* probably null Het
Ripk4 A C 16: 97,744,175 L361R probably damaging Het
Serpinb3d C T 1: 107,079,232 D249N probably benign Het
Skint10 A T 4: 112,773,027 probably null Het
Smg7 A T 1: 152,855,962 N349K probably benign Het
Sohlh2 C A 3: 55,207,683 S363Y probably damaging Het
Srsf10 A G 4: 135,863,868 T210A possibly damaging Het
Synpo2l A T 14: 20,660,680 M624K probably damaging Het
Thsd7a T A 6: 12,331,542 probably null Het
Tnc A T 4: 64,020,455 V49E probably damaging Het
Tnik A C 3: 28,650,159 K989T probably damaging Het
Tnxb T A 17: 34,671,918 Y412N probably damaging Het
Trmt44 A G 5: 35,568,759 probably null Het
Tsc2 A T 17: 24,621,712 V391E probably damaging Het
Ttll5 T C 12: 85,933,676 probably null Het
Usp28 A G 9: 49,024,060 I104V probably benign Het
Vmn1r64 A G 7: 5,884,097 L149S probably damaging Het
Yme1l1 T A 2: 23,192,515 M506K possibly damaging Het
Zfp280d T A 9: 72,307,965 F98I probably damaging Het
Zfp62 C A 11: 49,215,400 T106K probably benign Het
Other mutations in Nipsnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Nipsnap2 APN 5 129754851 missense probably damaging 0.99
IGL01012:Nipsnap2 APN 5 129746439 missense possibly damaging 0.91
IGL01320:Nipsnap2 APN 5 129744764 missense probably damaging 1.00
IGL01321:Nipsnap2 APN 5 129757141 makesense probably null
IGL02119:Nipsnap2 APN 5 129747992 splice site probably benign
IGL02636:Nipsnap2 APN 5 129745290 intron probably benign
R1497:Nipsnap2 UTSW 5 129753218 intron probably benign
R1649:Nipsnap2 UTSW 5 129753237 missense probably damaging 0.99
R1743:Nipsnap2 UTSW 5 129757085 missense probably damaging 1.00
R2020:Nipsnap2 UTSW 5 129753223 splice site probably null
R2187:Nipsnap2 UTSW 5 129746473 splice site probably null
R2215:Nipsnap2 UTSW 5 129739585 missense probably damaging 1.00
R2430:Nipsnap2 UTSW 5 129744791 missense possibly damaging 0.94
R3124:Nipsnap2 UTSW 5 129748034 critical splice donor site probably null
R5072:Nipsnap2 UTSW 5 129739580 missense probably damaging 1.00
R5150:Nipsnap2 UTSW 5 129757111 missense probably benign 0.03
R5823:Nipsnap2 UTSW 5 129739769 splice site probably null
R6736:Nipsnap2 UTSW 5 129745288 critical splice donor site probably null
R6913:Nipsnap2 UTSW 5 129753293 missense probably benign 0.11
R7163:Nipsnap2 UTSW 5 129744710 missense probably benign 0.00
R7597:Nipsnap2 UTSW 5 129739573 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acccagttcatttaccagcc -3'
Posted On2013-06-12