Incidental Mutation 'R0540:Cd209e'

• ID: 49826
• Institutional Source: Beutler Lab
• Gene Symbol: Cd209e
• Ensembl Gene: ENSMUSG00000040197
• Gene Name: CD209e antigen
• Synonyms: mSIGNR4, SIGNR4
• MMRRC Submission: 038732-MU
• Essential gene?: Probably non essential (E-score: 0.049)
• Stock #: R0540 (G1)
• Quality Score: 225
• Status: Not validated
• Chromosome: 8
• Chromosomal Location: 3847965-3854309 bp(-) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): T to C at 3851265 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Lysine to Glutamic Acid at position 130 (K130E)
• Ref Sequence: ENSEMBL: ENSMUSP00000033888
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000033888]
• AlphaFold: Q91ZW7
• Predicted Effect: probably benign; Transcript: ENSMUST00000033888; AA Change: K130E; PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
• SMART Domains: Protein: ENSMUSP00000033888; Gene: ENSMUSG00000040197; AA Change: K130E

Domain	Start	End	E-Value	Type
transmembrane domain	15	37	N/A	INTRINSIC
CLECT	77	198	4.01e-33	SMART

• Coding Region Coverage:
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.7%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
• Posted On: 2013-06-12

Predicted Primers

PCR Primer
(F):5'- TTTTGATTACCCACACAGGCTACAGAC -3'
(R):5'- CCACTTATCCCTGAGCATTGATAGGC -3'

Sequencing Primer
(F):5'- CTTATTTCCAAAAGGCCAGGG -3'
(R):5'- tgctgagggatggaaagaaac -3'