Incidental Mutation 'R0540:Ano4'
ID49838
Institutional Source Beutler Lab
Gene Symbol Ano4
Ensembl Gene ENSMUSG00000035189
Gene Nameanoctamin 4
SynonymsA330096O15Rik, Tmem16d
MMRRC Submission 038732-MU
Accession Numbers

Ncbi RefSeq: NM_178773.4; MGI: 2443344

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0540 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88948994-89344762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89023944 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 395 (I395F)
Ref Sequence ENSEMBL: ENSMUSP00000138193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182341] [ENSMUST00000182462] [ENSMUST00000182613] [ENSMUST00000182790]
Predicted Effect probably benign
Transcript: ENSMUST00000045601
AA Change: I224F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000043478
Gene: ENSMUSG00000035189
AA Change: I224F

DomainStartEndE-ValueType
Pfam:Anoct_dimer 16 165 2.7e-46 PFAM
Pfam:Anoctamin 168 750 1.9e-143 PFAM
low complexity region 761 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182041
Predicted Effect probably benign
Transcript: ENSMUST00000182341
AA Change: I395F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138193
Gene: ENSMUSG00000035189
AA Change: I395F

DomainStartEndE-ValueType
Pfam:Anoctamin 339 922 4.8e-162 PFAM
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182462
Predicted Effect probably benign
Transcript: ENSMUST00000182613
AA Change: I360F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138268
Gene: ENSMUSG00000035189
AA Change: I360F

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182790
AA Change: I360F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138325
Gene: ENSMUSG00000035189
AA Change: I360F

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182888
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A G 3: 60,019,206 T199A possibly damaging Het
Als2cl C A 9: 110,895,784 Y775* probably null Het
Ankhd1 G T 18: 36,640,280 V59F probably damaging Het
Apcdd1 A G 18: 62,951,896 N388S possibly damaging Het
Arl9 A G 5: 77,007,271 Y83C possibly damaging Het
Armc2 T A 10: 41,922,695 H706L probably benign Het
Arrb1 T C 7: 99,588,196 probably null Het
Atxn1 G A 13: 45,557,530 S642L probably damaging Het
Bmp8a A G 4: 123,315,930 Y322H probably damaging Het
Btbd3 C T 2: 138,283,816 R307W possibly damaging Het
C1galt1 T C 6: 7,871,193 I343T probably benign Het
Capn2 A T 1: 182,492,184 Y146* probably null Het
Ccdc42 C T 11: 68,597,710 Q312* probably null Het
Cd209e T C 8: 3,851,265 K130E probably benign Het
Chd3 T C 11: 69,344,358 D2054G probably damaging Het
Chrna1 T C 2: 73,571,471 N161S probably damaging Het
Clp1 C T 2: 84,725,591 A182T possibly damaging Het
Cpsf7 G T 19: 10,533,318 E135* probably null Het
Csf2rb2 T C 15: 78,287,908 Y325C probably benign Het
Cspg5 T C 9: 110,247,392 probably null Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cyp2b13 G A 7: 26,081,711 V183I probably benign Het
D430041D05Rik C T 2: 104,233,445 R1354H probably damaging Het
Ddx24 A G 12: 103,419,067 Y426H possibly damaging Het
Dexi G T 16: 10,542,562 Y43* probably null Het
Dlg1 G A 16: 31,838,174 V596I possibly damaging Het
Dnah11 A C 12: 118,082,511 W1731G probably damaging Het
Dnhd1 T A 7: 105,720,788 N4473K probably benign Het
Dync2h1 A C 9: 7,051,480 S3152A probably benign Het
Edn3 C A 2: 174,760,974 P3Q probably damaging Het
Eif2a G A 3: 58,555,652 probably null Het
Emb G A 13: 117,232,750 V56I possibly damaging Het
Enpp4 A T 17: 44,099,495 C397S probably damaging Het
Exo5 A G 4: 120,921,981 V229A probably damaging Het
Fga G A 3: 83,028,562 G32E probably damaging Het
Fkbpl T C 17: 34,645,359 F34L probably benign Het
Fsd2 T A 7: 81,545,017 D466V probably damaging Het
Gcn1l1 T C 5: 115,588,956 V624A probably benign Het
Git2 A G 5: 114,748,274 F336L probably damaging Het
Greb1 T A 12: 16,682,193 Y1589F probably damaging Het
H2-K1 G T 17: 33,999,500 D127E probably damaging Het
Ints8 A G 4: 11,252,926 V52A possibly damaging Het
Kifc1 G A 17: 33,886,647 T62I probably damaging Het
Klhl6 C A 16: 19,957,014 D265Y possibly damaging Het
Kmt5a T A 5: 124,451,310 N190K probably damaging Het
Lce6a A T 3: 92,620,328 H57Q probably benign Het
Lipo3 A T 19: 33,559,567 I251K possibly damaging Het
Lnpep A T 17: 17,538,554 F843I probably damaging Het
Lrrc45 C T 11: 120,715,162 R99* probably null Het
Lrrtm1 C A 6: 77,244,628 A356E probably damaging Het
Map3k1 A C 13: 111,763,510 H493Q probably benign Het
Mcm4 A T 16: 15,632,115 probably null Het
Mkl2 A G 16: 13,381,601 E106G probably damaging Het
Mllt3 G A 4: 87,841,044 P256S possibly damaging Het
Myo7a T A 7: 98,071,946 T1271S probably damaging Het
Ncan C A 8: 70,115,159 R101L possibly damaging Het
Ndufaf7 A G 17: 78,946,456 D361G probably benign Het
Neurod6 C T 6: 55,679,587 A22T probably benign Het
Nexn T A 3: 152,248,242 K192* probably null Het
Nipsnap2 A T 5: 129,754,845 Y234F probably damaging Het
Nlrp10 T C 7: 108,924,285 K663E probably benign Het
Nprl2 A T 9: 107,545,298 Y329F possibly damaging Het
Nr2f2 C A 7: 70,354,712 R264L probably damaging Het
Nsun7 A T 5: 66,283,634 K366I probably damaging Het
Nup35 T A 2: 80,642,640 M19K probably benign Het
Olfr1364 T A 13: 21,573,778 Y226F probably benign Het
Olfr1378 C A 11: 50,969,843 A275D possibly damaging Het
Olfr17 T A 7: 107,097,726 I87K probably benign Het
Olfr266 A T 3: 106,822,513 F15L probably damaging Het
Olfr312 T A 11: 58,831,972 S273T probably damaging Het
Olfr470 A G 7: 107,845,569 S55P probably damaging Het
Olfr56 C G 11: 49,134,722 H177D probably damaging Het
Patl2 T C 2: 122,126,669 Y128C probably benign Het
Pcdhac2 A G 18: 37,145,889 I641V probably benign Het
Peli3 T C 19: 4,941,911 M1V probably null Het
Pex16 T A 2: 92,375,637 L25* probably null Het
Plekhn1 C A 4: 156,222,747 A449S possibly damaging Het
Pot1b A T 17: 55,665,765 I469N probably damaging Het
Prdx6 A C 1: 161,251,103 L5W probably damaging Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Prss38 T C 11: 59,375,543 S30G possibly damaging Het
Rgs6 C A 12: 83,059,804 Y151* probably null Het
Ripk4 A C 16: 97,744,175 L361R probably damaging Het
Serpinb3d C T 1: 107,079,232 D249N probably benign Het
Skint10 A T 4: 112,773,027 probably null Het
Smg7 A T 1: 152,855,962 N349K probably benign Het
Sohlh2 C A 3: 55,207,683 S363Y probably damaging Het
Srsf10 A G 4: 135,863,868 T210A possibly damaging Het
Synpo2l A T 14: 20,660,680 M624K probably damaging Het
Thsd7a T A 6: 12,331,542 probably null Het
Tnc A T 4: 64,020,455 V49E probably damaging Het
Tnik A C 3: 28,650,159 K989T probably damaging Het
Tnxb T A 17: 34,671,918 Y412N probably damaging Het
Trmt44 A G 5: 35,568,759 probably null Het
Tsc2 A T 17: 24,621,712 V391E probably damaging Het
Ttll5 T C 12: 85,933,676 probably null Het
Usp28 A G 9: 49,024,060 I104V probably benign Het
Vmn1r64 A G 7: 5,884,097 L149S probably damaging Het
Yme1l1 T A 2: 23,192,515 M506K possibly damaging Het
Zfp280d T A 9: 72,307,965 F98I probably damaging Het
Zfp62 C A 11: 49,215,400 T106K probably benign Het
Other mutations in Ano4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Ano4 APN 10 88954667 missense probably damaging 1.00
IGL00916:Ano4 APN 10 88998098 missense probably benign 0.01
IGL01010:Ano4 APN 10 88960600 missense probably benign 0.14
IGL01015:Ano4 APN 10 89035099 missense probably damaging 1.00
IGL01877:Ano4 APN 10 89025070 nonsense probably null 0.00
IGL02310:Ano4 APN 10 89023878 nonsense probably null
IGL02390:Ano4 APN 10 89024981 missense possibly damaging 0.88
IGL02560:Ano4 APN 10 88978741 nonsense probably null
Dwindle UTSW 10 88983778 missense probably damaging 0.98
P0017:Ano4 UTSW 10 88981190 nonsense probably null
PIT4486001:Ano4 UTSW 10 88993029 missense probably damaging 1.00
R0126:Ano4 UTSW 10 88952292 missense possibly damaging 0.73
R0380:Ano4 UTSW 10 88978813 missense possibly damaging 0.82
R0508:Ano4 UTSW 10 88980977 missense probably damaging 1.00
R1802:Ano4 UTSW 10 88981016 missense probably damaging 1.00
R1864:Ano4 UTSW 10 88971391 missense probably damaging 1.00
R1871:Ano4 UTSW 10 88993027 missense probably damaging 1.00
R2829:Ano4 UTSW 10 89112939 missense possibly damaging 0.58
R2880:Ano4 UTSW 10 89112799 missense probably damaging 1.00
R3846:Ano4 UTSW 10 88995252 missense possibly damaging 0.93
R3904:Ano4 UTSW 10 89025005 missense probably damaging 1.00
R4006:Ano4 UTSW 10 89088263 missense probably benign 0.18
R4429:Ano4 UTSW 10 88992942 missense probably damaging 0.99
R4547:Ano4 UTSW 10 88981170 missense probably null
R4638:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4640:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4876:Ano4 UTSW 10 89112835 missense probably damaging 1.00
R5007:Ano4 UTSW 10 89112945 missense probably benign 0.26
R5104:Ano4 UTSW 10 89068112 missense possibly damaging 0.61
R5151:Ano4 UTSW 10 89112913 missense probably damaging 1.00
R5215:Ano4 UTSW 10 89317303 missense possibly damaging 0.86
R5396:Ano4 UTSW 10 89112840 missense probably damaging 1.00
R5826:Ano4 UTSW 10 88952327 missense probably damaging 1.00
R6018:Ano4 UTSW 10 89029266 missense probably benign 0.01
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6222:Ano4 UTSW 10 89027222 missense probably damaging 1.00
R6387:Ano4 UTSW 10 88971405 nonsense probably null
R6521:Ano4 UTSW 10 88983778 missense probably damaging 0.98
R6739:Ano4 UTSW 10 89027252 missense probably damaging 1.00
R6786:Ano4 UTSW 10 88992870 splice site probably null
R7035:Ano4 UTSW 10 88954711 missense probably damaging 1.00
R7523:Ano4 UTSW 10 88971395 nonsense probably null
R7715:Ano4 UTSW 10 88995311 missense probably damaging 0.99
R8005:Ano4 UTSW 10 88971321 missense probably benign 0.04
R8024:Ano4 UTSW 10 88971332 missense probably damaging 1.00
T0970:Ano4 UTSW 10 88981190 nonsense probably null
Z1176:Ano4 UTSW 10 89112945 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CAACACAATCTGAGGTTCAAACGTGG -3'
(R):5'- TGCAGAGACCCTAAGCAATAATGTTCC -3'

Sequencing Primer
(F):5'- CTGAGGTTCAAACGTGGGAAATAAC -3'
(R):5'- ttaataaatGCAGGGGTTGTTTACAC -3'
Posted On2013-06-12