Mutagenetix > Incidental Mutations

Incidental Mutation 'R0540:Chd3'

49845

Institutional Source

Beutler Lab

Gene Symbol

Chd3

Ensembl Gene

ENSMUSG00000018474

Gene Name

chromodomain helicase DNA binding protein 3

Synonyms

Chd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1

MMRRC Submission

038732-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0540 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69343273-69369406 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69344358 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2054 (D2054G)

Ref Sequence

ENSEMBL: ENSMUSP00000104301 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000129321] [ENSMUST00000151617] [ENSMUST00000218008]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092971
AA Change: D2020G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: D2020G

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	199	253	1.4e-34	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1754	1926	8.6e-104	PFAM
low complexity region	1935	1967	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108661
AA Change: D2054G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: D2054G

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	200	253	4.3e-29	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1789	1960	4.9e-93	PFAM
low complexity region	1969	2001	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122992

Predicted Effect

probably benign
Transcript: ENSMUST00000128981

SMART Domains

Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	55	87	N/A	INTRINSIC
Pfam:CHDNT	107	160	3.9e-29	PFAM
low complexity region	164	190	N/A	INTRINSIC
low complexity region	192	215	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
low complexity region	274	283	N/A	INTRINSIC
low complexity region	305	321	N/A	INTRINSIC
PHD	341	384	1.54e-14	SMART
RING	342	383	4.25e-1	SMART
PHD	417	460	1.74e-13	SMART
RING	418	459	3.93e0	SMART
CHROMO	465	544	7.23e-14	SMART
CHROMO	588	637	2.85e-12	SMART
low complexity region	656	662	N/A	INTRINSIC
DEXDc	691	903	1.64e-31	SMART
low complexity region	1014	1032	N/A	INTRINSIC
HELICc	1049	1133	2.61e-25	SMART
low complexity region	1197	1210	N/A	INTRINSIC
DUF1087	1252	1316	2.98e-33	SMART
DUF1086	1322	1478	1.79e-109	SMART
low complexity region	1480	1509	N/A	INTRINSIC
low complexity region	1579	1592	N/A	INTRINSIC
Pfam:CHDCT2	1662	1833	4.4e-93	PFAM
low complexity region	1842	1874	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129321

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135909

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146930

Predicted Effect

probably benign
Transcript: ENSMUST00000151617

Predicted Effect

probably benign
Transcript: ENSMUST00000218008

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.8%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl2	A	G	3: 60,019,206	T199A	possibly damaging	Het
Als2cl	C	A	9: 110,895,784	Y775*	probably null	Het
Ankhd1	G	T	18: 36,640,280	V59F	probably damaging	Het
Ano4	T	A	10: 89,023,944	I395F	probably benign	Het
Apcdd1	A	G	18: 62,951,896	N388S	possibly damaging	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Armc2	T	A	10: 41,922,695	H706L	probably benign	Het
Arrb1	T	C	7: 99,588,196		probably null	Het
Atxn1	G	A	13: 45,557,530	S642L	probably damaging	Het
Bmp8a	A	G	4: 123,315,930	Y322H	probably damaging	Het
Btbd3	C	T	2: 138,283,816	R307W	possibly damaging	Het
C1galt1	T	C	6: 7,871,193	I343T	probably benign	Het
Capn2	A	T	1: 182,492,184	Y146*	probably null	Het
Ccdc42	C	T	11: 68,597,710	Q312*	probably null	Het
Cd209e	T	C	8: 3,851,265	K130E	probably benign	Het
Chrna1	T	C	2: 73,571,471	N161S	probably damaging	Het
Clp1	C	T	2: 84,725,591	A182T	possibly damaging	Het
Cpsf7	G	T	19: 10,533,318	E135*	probably null	Het
Csf2rb2	T	C	15: 78,287,908	Y325C	probably benign	Het
Cspg5	T	C	9: 110,247,392		probably null	Het
Ctnna2	T	C	6: 76,902,430	T824A	probably benign	Het
Cyp2b13	G	A	7: 26,081,711	V183I	probably benign	Het
D430041D05Rik	C	T	2: 104,233,445	R1354H	probably damaging	Het
Ddx24	A	G	12: 103,419,067	Y426H	possibly damaging	Het
Dexi	G	T	16: 10,542,562	Y43*	probably null	Het
Dlg1	G	A	16: 31,838,174	V596I	possibly damaging	Het
Dnah11	A	C	12: 118,082,511	W1731G	probably damaging	Het
Dnhd1	T	A	7: 105,720,788	N4473K	probably benign	Het
Dync2h1	A	C	9: 7,051,480	S3152A	probably benign	Het
Edn3	C	A	2: 174,760,974	P3Q	probably damaging	Het
Eif2a	G	A	3: 58,555,652		probably null	Het
Emb	G	A	13: 117,232,750	V56I	possibly damaging	Het
Enpp4	A	T	17: 44,099,495	C397S	probably damaging	Het
Exo5	A	G	4: 120,921,981	V229A	probably damaging	Het
Fga	G	A	3: 83,028,562	G32E	probably damaging	Het
Fkbpl	T	C	17: 34,645,359	F34L	probably benign	Het
Fsd2	T	A	7: 81,545,017	D466V	probably damaging	Het
Gcn1l1	T	C	5: 115,588,956	V624A	probably benign	Het
Git2	A	G	5: 114,748,274	F336L	probably damaging	Het
Greb1	T	A	12: 16,682,193	Y1589F	probably damaging	Het
H2-K1	G	T	17: 33,999,500	D127E	probably damaging	Het
Ints8	A	G	4: 11,252,926	V52A	possibly damaging	Het
Kifc1	G	A	17: 33,886,647	T62I	probably damaging	Het
Klhl6	C	A	16: 19,957,014	D265Y	possibly damaging	Het
Kmt5a	T	A	5: 124,451,310	N190K	probably damaging	Het
Lce6a	A	T	3: 92,620,328	H57Q	probably benign	Het
Lipo3	A	T	19: 33,559,567	I251K	possibly damaging	Het
Lnpep	A	T	17: 17,538,554	F843I	probably damaging	Het
Lrrc45	C	T	11: 120,715,162	R99*	probably null	Het
Lrrtm1	C	A	6: 77,244,628	A356E	probably damaging	Het
Map3k1	A	C	13: 111,763,510	H493Q	probably benign	Het
Mcm4	A	T	16: 15,632,115		probably null	Het
Mkl2	A	G	16: 13,381,601	E106G	probably damaging	Het
Mllt3	G	A	4: 87,841,044	P256S	possibly damaging	Het
Myo7a	T	A	7: 98,071,946	T1271S	probably damaging	Het
Ncan	C	A	8: 70,115,159	R101L	possibly damaging	Het
Ndufaf7	A	G	17: 78,946,456	D361G	probably benign	Het
Neurod6	C	T	6: 55,679,587	A22T	probably benign	Het
Nexn	T	A	3: 152,248,242	K192*	probably null	Het
Nipsnap2	A	T	5: 129,754,845	Y234F	probably damaging	Het
Nlrp10	T	C	7: 108,924,285	K663E	probably benign	Het
Nprl2	A	T	9: 107,545,298	Y329F	possibly damaging	Het
Nr2f2	C	A	7: 70,354,712	R264L	probably damaging	Het
Nsun7	A	T	5: 66,283,634	K366I	probably damaging	Het
Nup35	T	A	2: 80,642,640	M19K	probably benign	Het
Olfr1364	T	A	13: 21,573,778	Y226F	probably benign	Het
Olfr1378	C	A	11: 50,969,843	A275D	possibly damaging	Het
Olfr17	T	A	7: 107,097,726	I87K	probably benign	Het
Olfr266	A	T	3: 106,822,513	F15L	probably damaging	Het
Olfr312	T	A	11: 58,831,972	S273T	probably damaging	Het
Olfr470	A	G	7: 107,845,569	S55P	probably damaging	Het
Olfr56	C	G	11: 49,134,722	H177D	probably damaging	Het
Patl2	T	C	2: 122,126,669	Y128C	probably benign	Het
Pcdhac2	A	G	18: 37,145,889	I641V	probably benign	Het
Peli3	T	C	19: 4,941,911	M1V	probably null	Het
Pex16	T	A	2: 92,375,637	L25*	probably null	Het
Plekhn1	C	A	4: 156,222,747	A449S	possibly damaging	Het
Pot1b	A	T	17: 55,665,765	I469N	probably damaging	Het
Prdx6	A	C	1: 161,251,103	L5W	probably damaging	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Prss38	T	C	11: 59,375,543	S30G	possibly damaging	Het
Rgs6	C	A	12: 83,059,804	Y151*	probably null	Het
Ripk4	A	C	16: 97,744,175	L361R	probably damaging	Het
Serpinb3d	C	T	1: 107,079,232	D249N	probably benign	Het
Skint10	A	T	4: 112,773,027		probably null	Het
Smg7	A	T	1: 152,855,962	N349K	probably benign	Het
Sohlh2	C	A	3: 55,207,683	S363Y	probably damaging	Het
Srsf10	A	G	4: 135,863,868	T210A	possibly damaging	Het
Synpo2l	A	T	14: 20,660,680	M624K	probably damaging	Het
Thsd7a	T	A	6: 12,331,542		probably null	Het
Tnc	A	T	4: 64,020,455	V49E	probably damaging	Het
Tnik	A	C	3: 28,650,159	K989T	probably damaging	Het
Tnxb	T	A	17: 34,671,918	Y412N	probably damaging	Het
Trmt44	A	G	5: 35,568,759		probably null	Het
Tsc2	A	T	17: 24,621,712	V391E	probably damaging	Het
Ttll5	T	C	12: 85,933,676		probably null	Het
Usp28	A	G	9: 49,024,060	I104V	probably benign	Het
Vmn1r64	A	G	7: 5,884,097	L149S	probably damaging	Het
Yme1l1	T	A	2: 23,192,515	M506K	possibly damaging	Het
Zfp280d	T	A	9: 72,307,965	F98I	probably damaging	Het
Zfp62	C	A	11: 49,215,400	T106K	probably benign	Het

Other mutations in Chd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Chd3	APN	11	69357062	missense	probably damaging	0.96
IGL00551:Chd3	APN	11	69346629	missense	probably damaging	1.00
IGL00661:Chd3	APN	11	69357383	missense	possibly damaging	0.84
IGL00698:Chd3	APN	11	69349871	missense	probably damaging	0.98
IGL01075:Chd3	APN	11	69359965	missense	probably damaging	1.00
IGL01309:Chd3	APN	11	69357731	missense	probably damaging	0.99
IGL01317:Chd3	APN	11	69353211	missense	probably damaging	1.00
IGL01374:Chd3	APN	11	69359980	missense	probably damaging	0.99
IGL01444:Chd3	APN	11	69348742	missense	probably benign	0.28
IGL01617:Chd3	APN	11	69358234	unclassified	probably benign
IGL01635:Chd3	APN	11	69361250	splice site	probably benign
IGL01942:Chd3	APN	11	69350105	critical splice donor site	probably null
IGL01962:Chd3	APN	11	69357493	missense	possibly damaging	0.46
IGL01981:Chd3	APN	11	69360675	missense	probably damaging	0.99
IGL02022:Chd3	APN	11	69361060	missense	probably damaging	1.00
IGL02098:Chd3	APN	11	69359829	missense	probably damaging	1.00
IGL02218:Chd3	APN	11	69352094	unclassified	probably benign
IGL02415:Chd3	APN	11	69348913	splice site	probably benign
IGL02648:Chd3	APN	11	69352150	missense	probably damaging	1.00
IGL02951:Chd3	APN	11	69361048	critical splice donor site	probably null
IGL03030:Chd3	APN	11	69354404	missense	possibly damaging	0.64
IGL03102:Chd3	APN	11	69361196	nonsense	probably null
IGL03168:Chd3	APN	11	69348915	splice site	probably benign
IGL03327:Chd3	APN	11	69350186	missense	probably damaging	1.00
burg	UTSW	11	69356554	missense	probably damaging	1.00
Fortress	UTSW	11	69364050	nonsense	probably null
Redoubt	UTSW	11	69353901	unclassified	probably benign
schloss	UTSW	11	69362060	nonsense	probably null
R0009:Chd3	UTSW	11	69349906	missense	probably damaging	0.99
R0009:Chd3	UTSW	11	69349906	missense	probably damaging	0.99
R0056:Chd3	UTSW	11	69359913	unclassified	probably benign
R0129:Chd3	UTSW	11	69348501	nonsense	probably null
R0130:Chd3	UTSW	11	69359830	missense	probably damaging	1.00
R0309:Chd3	UTSW	11	69357018	missense	probably damaging	1.00
R0330:Chd3	UTSW	11	69356333	missense	probably damaging	1.00
R0449:Chd3	UTSW	11	69357541	missense	probably damaging	0.98
R0502:Chd3	UTSW	11	69354105	missense	probably damaging	0.98
R0571:Chd3	UTSW	11	69361669	critical splice donor site	probably null
R0607:Chd3	UTSW	11	69344358	missense	probably damaging	0.98
R0616:Chd3	UTSW	11	69345487	missense	probably damaging	0.96
R0630:Chd3	UTSW	11	69347195	missense	probably damaging	1.00
R1436:Chd3	UTSW	11	69357574	splice site	probably null
R1484:Chd3	UTSW	11	69359899	missense	probably benign	0.17
R1741:Chd3	UTSW	11	69355654	missense	probably damaging	1.00
R1748:Chd3	UTSW	11	69364697	missense	possibly damaging	0.81
R1751:Chd3	UTSW	11	69353901	unclassified	probably benign
R1833:Chd3	UTSW	11	69354123	missense	probably damaging	1.00
R2012:Chd3	UTSW	11	69349052	missense	probably benign	0.01
R2101:Chd3	UTSW	11	69349051	missense	probably benign
R2147:Chd3	UTSW	11	69349028	missense	probably benign	0.00
R2513:Chd3	UTSW	11	69360645	missense	probably damaging	1.00
R2877:Chd3	UTSW	11	69361172	nonsense	probably null
R2879:Chd3	UTSW	11	69364098	missense	possibly damaging	0.52
R2880:Chd3	UTSW	11	69352120	missense	probably damaging	1.00
R2881:Chd3	UTSW	11	69352120	missense	probably damaging	1.00
R2973:Chd3	UTSW	11	69360616	missense	probably damaging	1.00
R3611:Chd3	UTSW	11	69362147	missense	possibly damaging	0.53
R3743:Chd3	UTSW	11	69364050	nonsense	probably null
R3845:Chd3	UTSW	11	69346759	missense	possibly damaging	0.65
R3889:Chd3	UTSW	11	69359185	missense	probably damaging	0.98
R4007:Chd3	UTSW	11	69349001	missense	probably benign
R4115:Chd3	UTSW	11	69357517	missense	possibly damaging	0.95
R4515:Chd3	UTSW	11	69349877	missense	probably benign	0.00
R4612:Chd3	UTSW	11	69353209	nonsense	probably null
R4622:Chd3	UTSW	11	69349008	missense	probably damaging	0.98
R4634:Chd3	UTSW	11	69362187	unclassified	probably benign
R4635:Chd3	UTSW	11	69362187	unclassified	probably benign
R4859:Chd3	UTSW	11	69359896	missense	possibly damaging	0.79
R4930:Chd3	UTSW	11	69354208	unclassified	probably benign
R5173:Chd3	UTSW	11	69369243	unclassified	probably benign
R5287:Chd3	UTSW	11	69349069	splice site	probably null
R5403:Chd3	UTSW	11	69349069	splice site	probably null
R5511:Chd3	UTSW	11	69361475	missense	probably damaging	1.00
R5666:Chd3	UTSW	11	69353351	missense	possibly damaging	0.83
R5702:Chd3	UTSW	11	69361435	missense	possibly damaging	0.46
R6045:Chd3	UTSW	11	69352118	missense	possibly damaging	0.90
R6063:Chd3	UTSW	11	69349237	missense	probably benign
R6211:Chd3	UTSW	11	69352677	missense	probably damaging	1.00
R6215:Chd3	UTSW	11	69356554	missense	probably damaging	1.00
R6217:Chd3	UTSW	11	69345535	missense	probably damaging	1.00
R6302:Chd3	UTSW	11	69353778	missense	probably damaging	0.98
R6329:Chd3	UTSW	11	69361684	missense	possibly damaging	0.70
R6349:Chd3	UTSW	11	69364031	missense	possibly damaging	0.50
R6414:Chd3	UTSW	11	69352545	critical splice donor site	probably null
R6453:Chd3	UTSW	11	69350112	nonsense	probably null
R6548:Chd3	UTSW	11	69362060	nonsense	probably null
R6582:Chd3	UTSW	11	69369156	unclassified	probably benign
R6721:Chd3	UTSW	11	69369219	unclassified	probably benign
R6776:Chd3	UTSW	11	69354470	missense	probably damaging	1.00
R6900:Chd3	UTSW	11	69354445	missense	possibly damaging	0.64
R7085:Chd3	UTSW	11	69369201	missense	unknown
R7136:Chd3	UTSW	11	69348438	missense	probably null	0.37
R7164:Chd3	UTSW	11	69362306	missense	probably damaging	1.00
R7200:Chd3	UTSW	11	69364095	missense	possibly damaging	0.94
R7226:Chd3	UTSW	11	69369211	missense	unknown
R7238:Chd3	UTSW	11	69364047	missense	probably benign	0.31
R7316:Chd3	UTSW	11	69345568	missense	probably damaging	0.99
R7560:Chd3	UTSW	11	69356270	missense	probably damaging	1.00
R7684:Chd3	UTSW	11	69357866	missense	possibly damaging	0.83
R7748:Chd3	UTSW	11	69355633	missense	probably benign	0.00
R7820:Chd3	UTSW	11	69353238	missense	probably damaging	1.00
R7885:Chd3	UTSW	11	69356625	missense	probably benign	0.13
R8150:Chd3	UTSW	11	69363684	missense	probably benign	0.02
R8161:Chd3	UTSW	11	69350885	missense	probably damaging	1.00
R8271:Chd3	UTSW	11	69360657	missense	probably damaging	1.00
R8334:Chd3	UTSW	11	69350796	missense	probably damaging	1.00
R8423:Chd3	UTSW	11	69354426	nonsense	probably null
X0022:Chd3	UTSW	11	69356258	missense	probably damaging	1.00
X0062:Chd3	UTSW	11	69354445	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- TTCACACCAGCACAGTCTTCAAGG -3'
(R):5'- TGGTTTCATATCGCCCACTTGAGC -3'

Sequencing Primer
(F):5'- CACAGTCTTCAAGGTTTGGTG -3'
(R):5'- CCTGTCACATCTTGGTACAAGAGG -3'

Posted On

2013-06-12