Mutagenetix > Incidental Mutation

Incidental Mutation 'R0540:Ddx24'

49851

Institutional Source

Beutler Lab

Gene Symbol

Ddx24

Ensembl Gene

ENSMUSG00000041645

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 24

Synonyms

2510027P10Rik, 1700055J08Rik

MMRRC Submission

038732-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0540 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103407982-103425830 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103419067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 426 (Y426H)

Ref Sequence

ENSEMBL: ENSMUSP00000105628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044923] [ENSMUST00000110001] [ENSMUST00000221211]

AlphaFold

Q9ESV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044923
AA Change: Y380H

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000040890
Gene: ENSMUSG00000041645
AA Change: Y380H

Domain	Start	End	E-Value	Type
low complexity region	94	101	N/A	INTRINSIC
low complexity region	105	114	N/A	INTRINSIC
low complexity region	154	162	N/A	INTRINSIC
low complexity region	168	180	N/A	INTRINSIC
DEXDc	212	541	1.14e-39	SMART
HELICc	601	682	5.22e-25	SMART
low complexity region	752	766	N/A	INTRINSIC
low complexity region	775	787	N/A	INTRINSIC
low complexity region	835	852	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110001
AA Change: Y426H

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105628
Gene: ENSMUSG00000041645
AA Change: Y426H

Domain	Start	End	E-Value	Type
low complexity region	140	147	N/A	INTRINSIC
low complexity region	151	160	N/A	INTRINSIC
low complexity region	200	208	N/A	INTRINSIC
low complexity region	214	226	N/A	INTRINSIC
DEXDc	258	587	1.14e-39	SMART
HELICc	647	728	5.22e-25	SMART
low complexity region	798	812	N/A	INTRINSIC
low complexity region	821	833	N/A	INTRINSIC
low complexity region	881	898	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220705

Predicted Effect

probably benign
Transcript: ENSMUST00000221211
AA Change: Y380H

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221358

Predicted Effect

probably benign
Transcript: ENSMUST00000222782

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.8%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which shows little similarity to any of the other known human DEAD box proteins, but shows a high similarity to mouse Ddx24 at the amino acid level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is embryonic lethal: embryos die between implantation and placentation. Heterozygous KO animals are viable and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl2	A	G	3: 60,019,206	T199A	possibly damaging	Het
Als2cl	C	A	9: 110,895,784	Y775*	probably null	Het
Ankhd1	G	T	18: 36,640,280	V59F	probably damaging	Het
Ano4	T	A	10: 89,023,944	I395F	probably benign	Het
Apcdd1	A	G	18: 62,951,896	N388S	possibly damaging	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Armc2	T	A	10: 41,922,695	H706L	probably benign	Het
Arrb1	T	C	7: 99,588,196		probably null	Het
Atxn1	G	A	13: 45,557,530	S642L	probably damaging	Het
Bmp8a	A	G	4: 123,315,930	Y322H	probably damaging	Het
Btbd3	C	T	2: 138,283,816	R307W	possibly damaging	Het
C1galt1	T	C	6: 7,871,193	I343T	probably benign	Het
Capn2	A	T	1: 182,492,184	Y146*	probably null	Het
Ccdc42	C	T	11: 68,597,710	Q312*	probably null	Het
Cd209e	T	C	8: 3,851,265	K130E	probably benign	Het
Chd3	T	C	11: 69,344,358	D2054G	probably damaging	Het
Chrna1	T	C	2: 73,571,471	N161S	probably damaging	Het
Clp1	C	T	2: 84,725,591	A182T	possibly damaging	Het
Cpsf7	G	T	19: 10,533,318	E135*	probably null	Het
Csf2rb2	T	C	15: 78,287,908	Y325C	probably benign	Het
Cspg5	T	C	9: 110,247,392		probably null	Het
Ctnna2	T	C	6: 76,902,430	T824A	probably benign	Het
Cyp2b13	G	A	7: 26,081,711	V183I	probably benign	Het
D430041D05Rik	C	T	2: 104,233,445	R1354H	probably damaging	Het
Dexi	G	T	16: 10,542,562	Y43*	probably null	Het
Dlg1	G	A	16: 31,838,174	V596I	possibly damaging	Het
Dnah11	A	C	12: 118,082,511	W1731G	probably damaging	Het
Dnhd1	T	A	7: 105,720,788	N4473K	probably benign	Het
Dync2h1	A	C	9: 7,051,480	S3152A	probably benign	Het
Edn3	C	A	2: 174,760,974	P3Q	probably damaging	Het
Eif2a	G	A	3: 58,555,652		probably null	Het
Emb	G	A	13: 117,232,750	V56I	possibly damaging	Het
Enpp4	A	T	17: 44,099,495	C397S	probably damaging	Het
Exo5	A	G	4: 120,921,981	V229A	probably damaging	Het
Fga	G	A	3: 83,028,562	G32E	probably damaging	Het
Fkbpl	T	C	17: 34,645,359	F34L	probably benign	Het
Fsd2	T	A	7: 81,545,017	D466V	probably damaging	Het
Gcn1l1	T	C	5: 115,588,956	V624A	probably benign	Het
Git2	A	G	5: 114,748,274	F336L	probably damaging	Het
Greb1	T	A	12: 16,682,193	Y1589F	probably damaging	Het
H2-K1	G	T	17: 33,999,500	D127E	probably damaging	Het
Ints8	A	G	4: 11,252,926	V52A	possibly damaging	Het
Kifc1	G	A	17: 33,886,647	T62I	probably damaging	Het
Klhl6	C	A	16: 19,957,014	D265Y	possibly damaging	Het
Kmt5a	T	A	5: 124,451,310	N190K	probably damaging	Het
Lce6a	A	T	3: 92,620,328	H57Q	probably benign	Het
Lipo3	A	T	19: 33,559,567	I251K	possibly damaging	Het
Lnpep	A	T	17: 17,538,554	F843I	probably damaging	Het
Lrrc45	C	T	11: 120,715,162	R99*	probably null	Het
Lrrtm1	C	A	6: 77,244,628	A356E	probably damaging	Het
Map3k1	A	C	13: 111,763,510	H493Q	probably benign	Het
Mcm4	A	T	16: 15,632,115		probably null	Het
Mkl2	A	G	16: 13,381,601	E106G	probably damaging	Het
Mllt3	G	A	4: 87,841,044	P256S	possibly damaging	Het
Myo7a	T	A	7: 98,071,946	T1271S	probably damaging	Het
Ncan	C	A	8: 70,115,159	R101L	possibly damaging	Het
Ndufaf7	A	G	17: 78,946,456	D361G	probably benign	Het
Neurod6	C	T	6: 55,679,587	A22T	probably benign	Het
Nexn	T	A	3: 152,248,242	K192*	probably null	Het
Nipsnap2	A	T	5: 129,754,845	Y234F	probably damaging	Het
Nlrp10	T	C	7: 108,924,285	K663E	probably benign	Het
Nprl2	A	T	9: 107,545,298	Y329F	possibly damaging	Het
Nr2f2	C	A	7: 70,354,712	R264L	probably damaging	Het
Nsun7	A	T	5: 66,283,634	K366I	probably damaging	Het
Nup35	T	A	2: 80,642,640	M19K	probably benign	Het
Olfr1364	T	A	13: 21,573,778	Y226F	probably benign	Het
Olfr1378	C	A	11: 50,969,843	A275D	possibly damaging	Het
Olfr17	T	A	7: 107,097,726	I87K	probably benign	Het
Olfr266	A	T	3: 106,822,513	F15L	probably damaging	Het
Olfr312	T	A	11: 58,831,972	S273T	probably damaging	Het
Olfr470	A	G	7: 107,845,569	S55P	probably damaging	Het
Olfr56	C	G	11: 49,134,722	H177D	probably damaging	Het
Patl2	T	C	2: 122,126,669	Y128C	probably benign	Het
Pcdhac2	A	G	18: 37,145,889	I641V	probably benign	Het
Peli3	T	C	19: 4,941,911	M1V	probably null	Het
Pex16	T	A	2: 92,375,637	L25*	probably null	Het
Plekhn1	C	A	4: 156,222,747	A449S	possibly damaging	Het
Pot1b	A	T	17: 55,665,765	I469N	probably damaging	Het
Prdx6	A	C	1: 161,251,103	L5W	probably damaging	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Prss38	T	C	11: 59,375,543	S30G	possibly damaging	Het
Rgs6	C	A	12: 83,059,804	Y151*	probably null	Het
Ripk4	A	C	16: 97,744,175	L361R	probably damaging	Het
Serpinb3d	C	T	1: 107,079,232	D249N	probably benign	Het
Skint10	A	T	4: 112,773,027		probably null	Het
Smg7	A	T	1: 152,855,962	N349K	probably benign	Het
Sohlh2	C	A	3: 55,207,683	S363Y	probably damaging	Het
Srsf10	A	G	4: 135,863,868	T210A	possibly damaging	Het
Synpo2l	A	T	14: 20,660,680	M624K	probably damaging	Het
Thsd7a	T	A	6: 12,331,542		probably null	Het
Tnc	A	T	4: 64,020,455	V49E	probably damaging	Het
Tnik	A	C	3: 28,650,159	K989T	probably damaging	Het
Tnxb	T	A	17: 34,671,918	Y412N	probably damaging	Het
Trmt44	A	G	5: 35,568,759		probably null	Het
Tsc2	A	T	17: 24,621,712	V391E	probably damaging	Het
Ttll5	T	C	12: 85,933,676		probably null	Het
Usp28	A	G	9: 49,024,060	I104V	probably benign	Het
Vmn1r64	A	G	7: 5,884,097	L149S	probably damaging	Het
Yme1l1	T	A	2: 23,192,515	M506K	possibly damaging	Het
Zfp280d	T	A	9: 72,307,965	F98I	probably damaging	Het
Zfp62	C	A	11: 49,215,400	T106K	probably benign	Het

Other mutations in Ddx24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02063:Ddx24	APN	12	103418202	missense	probably damaging	0.97
IGL02102:Ddx24	APN	12	103408484	intron	probably benign
IGL02225:Ddx24	APN	12	103417371	missense	probably damaging	1.00
IGL02226:Ddx24	APN	12	103424458	missense	possibly damaging	0.81
IGL02325:Ddx24	APN	12	103416266	missense	probably damaging	1.00
IGL02568:Ddx24	APN	12	103417312	missense	probably damaging	1.00
IGL02666:Ddx24	APN	12	103424055	missense	possibly damaging	0.94
IGL02950:Ddx24	APN	12	103417542	missense	probably damaging	1.00
IGL03244:Ddx24	APN	12	103417605	missense	possibly damaging	0.53
P0028:Ddx24	UTSW	12	103408375	missense	probably benign
R0195:Ddx24	UTSW	12	103418961	critical splice donor site	probably null
R0607:Ddx24	UTSW	12	103419067	missense	possibly damaging	0.92
R0621:Ddx24	UTSW	12	103425558	intron	probably benign
R0964:Ddx24	UTSW	12	103423907	missense	probably damaging	1.00
R1447:Ddx24	UTSW	12	103424307	missense	possibly damaging	0.88
R1639:Ddx24	UTSW	12	103411319	critical splice acceptor site	probably null
R1909:Ddx24	UTSW	12	103409982	missense	probably damaging	0.99
R2418:Ddx24	UTSW	12	103417737	missense	probably damaging	1.00
R3706:Ddx24	UTSW	12	103417416	missense	probably damaging	1.00
R3725:Ddx24	UTSW	12	103417605	missense	probably benign	0.19
R4436:Ddx24	UTSW	12	103423974	missense	probably damaging	1.00
R4807:Ddx24	UTSW	12	103419461	missense	probably damaging	1.00
R5568:Ddx24	UTSW	12	103424288	missense	possibly damaging	0.46
R5629:Ddx24	UTSW	12	103425547	intron	probably benign
R5763:Ddx24	UTSW	12	103417414	missense	probably damaging	1.00
R5891:Ddx24	UTSW	12	103424058	missense	probably damaging	1.00
R6059:Ddx24	UTSW	12	103408300	missense	probably damaging	1.00
R6310:Ddx24	UTSW	12	103423907	missense	probably damaging	1.00
R6311:Ddx24	UTSW	12	103423907	missense	probably damaging	1.00
R6408:Ddx24	UTSW	12	103425560	intron	probably benign
R6648:Ddx24	UTSW	12	103408375	missense	probably benign	0.02
R7151:Ddx24	UTSW	12	103424088	missense	probably benign	0.00
R7299:Ddx24	UTSW	12	103419450	missense	possibly damaging	0.95
R7301:Ddx24	UTSW	12	103419450	missense	possibly damaging	0.95
R7324:Ddx24	UTSW	12	103416259	missense	probably damaging	1.00
R7513:Ddx24	UTSW	12	103419106	nonsense	probably null
R7602:Ddx24	UTSW	12	103416260	nonsense	probably null
R7734:Ddx24	UTSW	12	103417560	missense	possibly damaging	0.49
R8076:Ddx24	UTSW	12	103416218	missense	probably damaging	1.00
R8466:Ddx24	UTSW	12	103409901	missense	probably benign	0.01
R8914:Ddx24	UTSW	12	103424406	missense	possibly damaging	0.86
R9484:Ddx24	UTSW	12	103411296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAATGCCCCAGCAGATGAGCAC -3'
(R):5'- AGAATTGAGACTGAAGCACAGCCC -3'

Sequencing Primer
(F):5'- AGGAGCCACAACTCTTACTCTTG -3'
(R):5'- ACCTGAGACTAGTGCCTCTG -3'

Posted On

2013-06-12