Incidental Mutation 'R0540:Klhl6'
ID49864
Institutional Source Beutler Lab
Gene Symbol Klhl6
Ensembl Gene ENSMUSG00000043008
Gene Namekelch-like 6
Synonyms
MMRRC Submission 038732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0540 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19946496-19983037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19957014 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 265 (D265Y)
Ref Sequence ENSEMBL: ENSMUSP00000053023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058839] [ENSMUST00000166801]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058839
AA Change: D265Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: D265Y

DomainStartEndE-ValueType
BTB 70 167 1.43e-25 SMART
BACK 172 274 1.68e-35 SMART
Kelch 376 419 3.05e-1 SMART
Kelch 420 466 6.82e-11 SMART
Kelch 467 514 4.27e-3 SMART
Kelch 515 556 3.06e-4 SMART
Kelch 557 604 3.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166801
SMART Domains Protein: ENSMUSP00000130755
Gene: ENSMUSG00000043008

DomainStartEndE-ValueType
Pfam:BTB 60 98 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171910
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A G 3: 60,019,206 T199A possibly damaging Het
Als2cl C A 9: 110,895,784 Y775* probably null Het
Ankhd1 G T 18: 36,640,280 V59F probably damaging Het
Ano4 T A 10: 89,023,944 I395F probably benign Het
Apcdd1 A G 18: 62,951,896 N388S possibly damaging Het
Arl9 A G 5: 77,007,271 Y83C possibly damaging Het
Armc2 T A 10: 41,922,695 H706L probably benign Het
Arrb1 T C 7: 99,588,196 probably null Het
Atxn1 G A 13: 45,557,530 S642L probably damaging Het
Bmp8a A G 4: 123,315,930 Y322H probably damaging Het
Btbd3 C T 2: 138,283,816 R307W possibly damaging Het
C1galt1 T C 6: 7,871,193 I343T probably benign Het
Capn2 A T 1: 182,492,184 Y146* probably null Het
Ccdc42 C T 11: 68,597,710 Q312* probably null Het
Cd209e T C 8: 3,851,265 K130E probably benign Het
Chd3 T C 11: 69,344,358 D2054G probably damaging Het
Chrna1 T C 2: 73,571,471 N161S probably damaging Het
Clp1 C T 2: 84,725,591 A182T possibly damaging Het
Cpsf7 G T 19: 10,533,318 E135* probably null Het
Csf2rb2 T C 15: 78,287,908 Y325C probably benign Het
Cspg5 T C 9: 110,247,392 probably null Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cyp2b13 G A 7: 26,081,711 V183I probably benign Het
D430041D05Rik C T 2: 104,233,445 R1354H probably damaging Het
Ddx24 A G 12: 103,419,067 Y426H possibly damaging Het
Dexi G T 16: 10,542,562 Y43* probably null Het
Dlg1 G A 16: 31,838,174 V596I possibly damaging Het
Dnah11 A C 12: 118,082,511 W1731G probably damaging Het
Dnhd1 T A 7: 105,720,788 N4473K probably benign Het
Dync2h1 A C 9: 7,051,480 S3152A probably benign Het
Edn3 C A 2: 174,760,974 P3Q probably damaging Het
Eif2a G A 3: 58,555,652 probably null Het
Emb G A 13: 117,232,750 V56I possibly damaging Het
Enpp4 A T 17: 44,099,495 C397S probably damaging Het
Exo5 A G 4: 120,921,981 V229A probably damaging Het
Fga G A 3: 83,028,562 G32E probably damaging Het
Fkbpl T C 17: 34,645,359 F34L probably benign Het
Fsd2 T A 7: 81,545,017 D466V probably damaging Het
Gcn1l1 T C 5: 115,588,956 V624A probably benign Het
Git2 A G 5: 114,748,274 F336L probably damaging Het
Greb1 T A 12: 16,682,193 Y1589F probably damaging Het
H2-K1 G T 17: 33,999,500 D127E probably damaging Het
Ints8 A G 4: 11,252,926 V52A possibly damaging Het
Kifc1 G A 17: 33,886,647 T62I probably damaging Het
Kmt5a T A 5: 124,451,310 N190K probably damaging Het
Lce6a A T 3: 92,620,328 H57Q probably benign Het
Lipo3 A T 19: 33,559,567 I251K possibly damaging Het
Lnpep A T 17: 17,538,554 F843I probably damaging Het
Lrrc45 C T 11: 120,715,162 R99* probably null Het
Lrrtm1 C A 6: 77,244,628 A356E probably damaging Het
Map3k1 A C 13: 111,763,510 H493Q probably benign Het
Mcm4 A T 16: 15,632,115 probably null Het
Mkl2 A G 16: 13,381,601 E106G probably damaging Het
Mllt3 G A 4: 87,841,044 P256S possibly damaging Het
Myo7a T A 7: 98,071,946 T1271S probably damaging Het
Ncan C A 8: 70,115,159 R101L possibly damaging Het
Ndufaf7 A G 17: 78,946,456 D361G probably benign Het
Neurod6 C T 6: 55,679,587 A22T probably benign Het
Nexn T A 3: 152,248,242 K192* probably null Het
Nipsnap2 A T 5: 129,754,845 Y234F probably damaging Het
Nlrp10 T C 7: 108,924,285 K663E probably benign Het
Nprl2 A T 9: 107,545,298 Y329F possibly damaging Het
Nr2f2 C A 7: 70,354,712 R264L probably damaging Het
Nsun7 A T 5: 66,283,634 K366I probably damaging Het
Nup35 T A 2: 80,642,640 M19K probably benign Het
Olfr1364 T A 13: 21,573,778 Y226F probably benign Het
Olfr1378 C A 11: 50,969,843 A275D possibly damaging Het
Olfr17 T A 7: 107,097,726 I87K probably benign Het
Olfr266 A T 3: 106,822,513 F15L probably damaging Het
Olfr312 T A 11: 58,831,972 S273T probably damaging Het
Olfr470 A G 7: 107,845,569 S55P probably damaging Het
Olfr56 C G 11: 49,134,722 H177D probably damaging Het
Patl2 T C 2: 122,126,669 Y128C probably benign Het
Pcdhac2 A G 18: 37,145,889 I641V probably benign Het
Peli3 T C 19: 4,941,911 M1V probably null Het
Pex16 T A 2: 92,375,637 L25* probably null Het
Plekhn1 C A 4: 156,222,747 A449S possibly damaging Het
Pot1b A T 17: 55,665,765 I469N probably damaging Het
Prdx6 A C 1: 161,251,103 L5W probably damaging Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Prss38 T C 11: 59,375,543 S30G possibly damaging Het
Rgs6 C A 12: 83,059,804 Y151* probably null Het
Ripk4 A C 16: 97,744,175 L361R probably damaging Het
Serpinb3d C T 1: 107,079,232 D249N probably benign Het
Skint10 A T 4: 112,773,027 probably null Het
Smg7 A T 1: 152,855,962 N349K probably benign Het
Sohlh2 C A 3: 55,207,683 S363Y probably damaging Het
Srsf10 A G 4: 135,863,868 T210A possibly damaging Het
Synpo2l A T 14: 20,660,680 M624K probably damaging Het
Thsd7a T A 6: 12,331,542 probably null Het
Tnc A T 4: 64,020,455 V49E probably damaging Het
Tnik A C 3: 28,650,159 K989T probably damaging Het
Tnxb T A 17: 34,671,918 Y412N probably damaging Het
Trmt44 A G 5: 35,568,759 probably null Het
Tsc2 A T 17: 24,621,712 V391E probably damaging Het
Ttll5 T C 12: 85,933,676 probably null Het
Usp28 A G 9: 49,024,060 I104V probably benign Het
Vmn1r64 A G 7: 5,884,097 L149S probably damaging Het
Yme1l1 T A 2: 23,192,515 M506K possibly damaging Het
Zfp280d T A 9: 72,307,965 F98I probably damaging Het
Zfp62 C A 11: 49,215,400 T106K probably benign Het
Other mutations in Klhl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Klhl6 APN 16 19957062 missense probably benign 0.00
IGL01465:Klhl6 APN 16 19982822 missense probably damaging 0.98
IGL01831:Klhl6 APN 16 19953485 missense probably damaging 1.00
IGL01971:Klhl6 APN 16 19949526 missense probably damaging 0.99
IGL02532:Klhl6 APN 16 19957082 missense possibly damaging 0.84
IGL03113:Klhl6 APN 16 19957251 missense possibly damaging 0.68
IGL03290:Klhl6 APN 16 19947137 missense probably benign 0.44
Ascension UTSW 16 19947098 missense probably damaging 1.00
besmirched UTSW 16 19949447 splice site probably null
blau UTSW 16 19957005 missense probably damaging 1.00
blossom UTSW 16 19957139 missense probably damaging 1.00
cerulean UTSW 16 19957218 nonsense probably null
grossbeak UTSW 16 19949451 missense probably null 1.00
heights UTSW 16 19957028 missense probably damaging 0.98
Lazuli UTSW 16 19956966 frame shift probably null
Parula UTSW 16 19957043 missense possibly damaging 0.56
torres_del_paine UTSW 16 19948127 missense probably damaging 1.00
turquoise UTSW 16 19982796 missense probably damaging 1.00
IGL03046:Klhl6 UTSW 16 19982889 missense probably benign
R0265:Klhl6 UTSW 16 19948234 missense probably benign 0.43
R0496:Klhl6 UTSW 16 19956966 frame shift probably null
R0497:Klhl6 UTSW 16 19956966 frame shift probably null
R0541:Klhl6 UTSW 16 19949447 splice site probably null
R0554:Klhl6 UTSW 16 19953593 missense probably damaging 0.96
R0607:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0636:Klhl6 UTSW 16 19948073 splice site probably benign
R0670:Klhl6 UTSW 16 19949559 missense possibly damaging 0.92
R1477:Klhl6 UTSW 16 19965977 missense probably benign 0.00
R1510:Klhl6 UTSW 16 19947098 missense probably damaging 1.00
R1547:Klhl6 UTSW 16 19966082 missense probably benign
R1747:Klhl6 UTSW 16 19947028 missense probably benign 0.40
R1871:Klhl6 UTSW 16 19957043 missense possibly damaging 0.56
R1966:Klhl6 UTSW 16 19982822 missense probably damaging 0.98
R2058:Klhl6 UTSW 16 19982931 missense probably benign
R4466:Klhl6 UTSW 16 19957268 missense probably damaging 0.99
R4645:Klhl6 UTSW 16 19947147 missense probably damaging 1.00
R4690:Klhl6 UTSW 16 19957284 missense probably benign 0.44
R4824:Klhl6 UTSW 16 19957028 missense probably damaging 0.98
R4833:Klhl6 UTSW 16 19957139 missense probably damaging 1.00
R4835:Klhl6 UTSW 16 19957033 missense probably benign 0.07
R5001:Klhl6 UTSW 16 19946991 makesense probably null
R5475:Klhl6 UTSW 16 19948127 missense probably damaging 1.00
R5700:Klhl6 UTSW 16 19957218 nonsense probably null
R5867:Klhl6 UTSW 16 19982820 missense probably benign 0.37
R5910:Klhl6 UTSW 16 19957094 missense probably benign 0.04
R6992:Klhl6 UTSW 16 19953587 missense probably damaging 1.00
R7082:Klhl6 UTSW 16 19982883 missense probably benign 0.00
R7262:Klhl6 UTSW 16 19982796 missense probably damaging 1.00
R7314:Klhl6 UTSW 16 19957005 missense probably damaging 1.00
R7464:Klhl6 UTSW 16 19957113 missense possibly damaging 0.58
R7688:Klhl6 UTSW 16 19947131 missense probably damaging 1.00
R7957:Klhl6 UTSW 16 19949451 missense probably null 1.00
R8319:Klhl6 UTSW 16 19957190 missense possibly damaging 0.74
R8460:Klhl6 UTSW 16 19957031 missense probably damaging 1.00
Z1176:Klhl6 UTSW 16 19953674 missense probably damaging 1.00
Z1177:Klhl6 UTSW 16 19982961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGACAAGAGTCCCTGGATAATGC -3'
(R):5'- TGGCAGACACACATTCTTTGGACAG -3'

Sequencing Primer
(F):5'- AGAGTCCCTGGATAATGCCTTAC -3'
(R):5'- TGGACAGTTTAAAGATGCAAGTC -3'
Posted On2013-06-12