Mutagenetix > Incidental Mutation

Incidental Mutation 'R0540:Klhl6'

49864

Institutional Source

Beutler Lab

Gene Symbol

Klhl6

Ensembl Gene

ENSMUSG00000043008

Gene Name

kelch-like 6

Synonyms

MMRRC Submission

038732-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R0540 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19946496-19983037 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 19957014 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 265 (D265Y)

Ref Sequence

ENSEMBL: ENSMUSP00000053023 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058839] [ENSMUST00000166801]

AlphaFold

Q6V595

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058839
AA Change: D265Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: D265Y

Domain	Start	End	E-Value	Type
BTB	70	167	1.43e-25	SMART
BACK	172	274	1.68e-35	SMART
Kelch	376	419	3.05e-1	SMART
Kelch	420	466	6.82e-11	SMART
Kelch	467	514	4.27e-3	SMART
Kelch	515	556	3.06e-4	SMART
Kelch	557	604	3.47e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166801

SMART Domains

Protein: ENSMUSP00000130755
Gene: ENSMUSG00000043008

Domain	Start	End	E-Value	Type
Pfam:BTB	60	98	1.2e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171910

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.8%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl2	A	G	3: 60,019,206	T199A	possibly damaging	Het
Als2cl	C	A	9: 110,895,784	Y775*	probably null	Het
Ankhd1	G	T	18: 36,640,280	V59F	probably damaging	Het
Ano4	T	A	10: 89,023,944	I395F	probably benign	Het
Apcdd1	A	G	18: 62,951,896	N388S	possibly damaging	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Armc2	T	A	10: 41,922,695	H706L	probably benign	Het
Arrb1	T	C	7: 99,588,196		probably null	Het
Atxn1	G	A	13: 45,557,530	S642L	probably damaging	Het
Bmp8a	A	G	4: 123,315,930	Y322H	probably damaging	Het
Btbd3	C	T	2: 138,283,816	R307W	possibly damaging	Het
C1galt1	T	C	6: 7,871,193	I343T	probably benign	Het
Capn2	A	T	1: 182,492,184	Y146*	probably null	Het
Ccdc42	C	T	11: 68,597,710	Q312*	probably null	Het
Cd209e	T	C	8: 3,851,265	K130E	probably benign	Het
Chd3	T	C	11: 69,344,358	D2054G	probably damaging	Het
Chrna1	T	C	2: 73,571,471	N161S	probably damaging	Het
Clp1	C	T	2: 84,725,591	A182T	possibly damaging	Het
Cpsf7	G	T	19: 10,533,318	E135*	probably null	Het
Csf2rb2	T	C	15: 78,287,908	Y325C	probably benign	Het
Cspg5	T	C	9: 110,247,392		probably null	Het
Ctnna2	T	C	6: 76,902,430	T824A	probably benign	Het
Cyp2b13	G	A	7: 26,081,711	V183I	probably benign	Het
D430041D05Rik	C	T	2: 104,233,445	R1354H	probably damaging	Het
Ddx24	A	G	12: 103,419,067	Y426H	possibly damaging	Het
Dexi	G	T	16: 10,542,562	Y43*	probably null	Het
Dlg1	G	A	16: 31,838,174	V596I	possibly damaging	Het
Dnah11	A	C	12: 118,082,511	W1731G	probably damaging	Het
Dnhd1	T	A	7: 105,720,788	N4473K	probably benign	Het
Dync2h1	A	C	9: 7,051,480	S3152A	probably benign	Het
Edn3	C	A	2: 174,760,974	P3Q	probably damaging	Het
Eif2a	G	A	3: 58,555,652		probably null	Het
Emb	G	A	13: 117,232,750	V56I	possibly damaging	Het
Enpp4	A	T	17: 44,099,495	C397S	probably damaging	Het
Exo5	A	G	4: 120,921,981	V229A	probably damaging	Het
Fga	G	A	3: 83,028,562	G32E	probably damaging	Het
Fkbpl	T	C	17: 34,645,359	F34L	probably benign	Het
Fsd2	T	A	7: 81,545,017	D466V	probably damaging	Het
Gcn1l1	T	C	5: 115,588,956	V624A	probably benign	Het
Git2	A	G	5: 114,748,274	F336L	probably damaging	Het
Greb1	T	A	12: 16,682,193	Y1589F	probably damaging	Het
H2-K1	G	T	17: 33,999,500	D127E	probably damaging	Het
Ints8	A	G	4: 11,252,926	V52A	possibly damaging	Het
Kifc1	G	A	17: 33,886,647	T62I	probably damaging	Het
Kmt5a	T	A	5: 124,451,310	N190K	probably damaging	Het
Lce6a	A	T	3: 92,620,328	H57Q	probably benign	Het
Lipo3	A	T	19: 33,559,567	I251K	possibly damaging	Het
Lnpep	A	T	17: 17,538,554	F843I	probably damaging	Het
Lrrc45	C	T	11: 120,715,162	R99*	probably null	Het
Lrrtm1	C	A	6: 77,244,628	A356E	probably damaging	Het
Map3k1	A	C	13: 111,763,510	H493Q	probably benign	Het
Mcm4	A	T	16: 15,632,115		probably null	Het
Mkl2	A	G	16: 13,381,601	E106G	probably damaging	Het
Mllt3	G	A	4: 87,841,044	P256S	possibly damaging	Het
Myo7a	T	A	7: 98,071,946	T1271S	probably damaging	Het
Ncan	C	A	8: 70,115,159	R101L	possibly damaging	Het
Ndufaf7	A	G	17: 78,946,456	D361G	probably benign	Het
Neurod6	C	T	6: 55,679,587	A22T	probably benign	Het
Nexn	T	A	3: 152,248,242	K192*	probably null	Het
Nipsnap2	A	T	5: 129,754,845	Y234F	probably damaging	Het
Nlrp10	T	C	7: 108,924,285	K663E	probably benign	Het
Nprl2	A	T	9: 107,545,298	Y329F	possibly damaging	Het
Nr2f2	C	A	7: 70,354,712	R264L	probably damaging	Het
Nsun7	A	T	5: 66,283,634	K366I	probably damaging	Het
Nup35	T	A	2: 80,642,640	M19K	probably benign	Het
Olfr1364	T	A	13: 21,573,778	Y226F	probably benign	Het
Olfr1378	C	A	11: 50,969,843	A275D	possibly damaging	Het
Olfr17	T	A	7: 107,097,726	I87K	probably benign	Het
Olfr266	A	T	3: 106,822,513	F15L	probably damaging	Het
Olfr312	T	A	11: 58,831,972	S273T	probably damaging	Het
Olfr470	A	G	7: 107,845,569	S55P	probably damaging	Het
Olfr56	C	G	11: 49,134,722	H177D	probably damaging	Het
Patl2	T	C	2: 122,126,669	Y128C	probably benign	Het
Pcdhac2	A	G	18: 37,145,889	I641V	probably benign	Het
Peli3	T	C	19: 4,941,911	M1V	probably null	Het
Pex16	T	A	2: 92,375,637	L25*	probably null	Het
Plekhn1	C	A	4: 156,222,747	A449S	possibly damaging	Het
Pot1b	A	T	17: 55,665,765	I469N	probably damaging	Het
Prdx6	A	C	1: 161,251,103	L5W	probably damaging	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Prss38	T	C	11: 59,375,543	S30G	possibly damaging	Het
Rgs6	C	A	12: 83,059,804	Y151*	probably null	Het
Ripk4	A	C	16: 97,744,175	L361R	probably damaging	Het
Serpinb3d	C	T	1: 107,079,232	D249N	probably benign	Het
Skint10	A	T	4: 112,773,027		probably null	Het
Smg7	A	T	1: 152,855,962	N349K	probably benign	Het
Sohlh2	C	A	3: 55,207,683	S363Y	probably damaging	Het
Srsf10	A	G	4: 135,863,868	T210A	possibly damaging	Het
Synpo2l	A	T	14: 20,660,680	M624K	probably damaging	Het
Thsd7a	T	A	6: 12,331,542		probably null	Het
Tnc	A	T	4: 64,020,455	V49E	probably damaging	Het
Tnik	A	C	3: 28,650,159	K989T	probably damaging	Het
Tnxb	T	A	17: 34,671,918	Y412N	probably damaging	Het
Trmt44	A	G	5: 35,568,759		probably null	Het
Tsc2	A	T	17: 24,621,712	V391E	probably damaging	Het
Ttll5	T	C	12: 85,933,676		probably null	Het
Usp28	A	G	9: 49,024,060	I104V	probably benign	Het
Vmn1r64	A	G	7: 5,884,097	L149S	probably damaging	Het
Yme1l1	T	A	2: 23,192,515	M506K	possibly damaging	Het
Zfp280d	T	A	9: 72,307,965	F98I	probably damaging	Het
Zfp62	C	A	11: 49,215,400	T106K	probably benign	Het

Other mutations in Klhl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Klhl6	APN	16	19957062	missense	probably benign	0.00
IGL01465:Klhl6	APN	16	19982822	missense	probably damaging	0.98
IGL01831:Klhl6	APN	16	19953485	missense	probably damaging	1.00
IGL01971:Klhl6	APN	16	19949526	missense	probably damaging	0.99
IGL02532:Klhl6	APN	16	19957082	missense	possibly damaging	0.84
IGL03113:Klhl6	APN	16	19957251	missense	possibly damaging	0.68
IGL03290:Klhl6	APN	16	19947137	missense	probably benign	0.44
Ascension	UTSW	16	19947098	missense	probably damaging	1.00
besmirched	UTSW	16	19949447	splice site	probably null
blau	UTSW	16	19957005	missense	probably damaging	1.00
blossom	UTSW	16	19957139	missense	probably damaging	1.00
Breech	UTSW	16	19948234	missense	probably benign	0.43
cerulean	UTSW	16	19957218	nonsense	probably null
cobalt	UTSW	16	19957022	missense	probably damaging	1.00
grossbeak	UTSW	16	19949451	missense	probably null	1.00
heights	UTSW	16	19957028	missense	probably damaging	0.98
Lazuli	UTSW	16	19956966	frame shift	probably null
Parula	UTSW	16	19957043	missense	possibly damaging	0.56
sideways	UTSW	16	19957268	missense	probably damaging	0.99
torres_del_paine	UTSW	16	19948127	missense	probably damaging	1.00
turquoise	UTSW	16	19982796	missense	probably damaging	1.00
IGL03046:Klhl6	UTSW	16	19982889	missense	probably benign
R0265:Klhl6	UTSW	16	19948234	missense	probably benign	0.43
R0496:Klhl6	UTSW	16	19956966	frame shift	probably null
R0497:Klhl6	UTSW	16	19956966	frame shift	probably null
R0541:Klhl6	UTSW	16	19949447	splice site	probably null
R0554:Klhl6	UTSW	16	19953593	missense	probably damaging	0.96
R0607:Klhl6	UTSW	16	19957014	missense	possibly damaging	0.95
R0636:Klhl6	UTSW	16	19948073	splice site	probably benign
R0670:Klhl6	UTSW	16	19949559	missense	possibly damaging	0.92
R1477:Klhl6	UTSW	16	19965977	missense	probably benign	0.00
R1510:Klhl6	UTSW	16	19947098	missense	probably damaging	1.00
R1547:Klhl6	UTSW	16	19966082	missense	probably benign
R1747:Klhl6	UTSW	16	19947028	missense	probably benign	0.40
R1871:Klhl6	UTSW	16	19957043	missense	possibly damaging	0.56
R1966:Klhl6	UTSW	16	19982822	missense	probably damaging	0.98
R2058:Klhl6	UTSW	16	19982931	missense	probably benign
R4466:Klhl6	UTSW	16	19957268	missense	probably damaging	0.99
R4645:Klhl6	UTSW	16	19947147	missense	probably damaging	1.00
R4690:Klhl6	UTSW	16	19957284	missense	probably benign	0.44
R4824:Klhl6	UTSW	16	19957028	missense	probably damaging	0.98
R4833:Klhl6	UTSW	16	19957139	missense	probably damaging	1.00
R4835:Klhl6	UTSW	16	19957033	missense	probably benign	0.07
R5001:Klhl6	UTSW	16	19946991	makesense	probably null
R5475:Klhl6	UTSW	16	19948127	missense	probably damaging	1.00
R5700:Klhl6	UTSW	16	19957218	nonsense	probably null
R5867:Klhl6	UTSW	16	19982820	missense	probably benign	0.37
R5910:Klhl6	UTSW	16	19957094	missense	probably benign	0.04
R6992:Klhl6	UTSW	16	19953587	missense	probably damaging	1.00
R7082:Klhl6	UTSW	16	19982883	missense	probably benign	0.00
R7262:Klhl6	UTSW	16	19982796	missense	probably damaging	1.00
R7314:Klhl6	UTSW	16	19957005	missense	probably damaging	1.00
R7464:Klhl6	UTSW	16	19957113	missense	possibly damaging	0.58
R7688:Klhl6	UTSW	16	19947131	missense	probably damaging	1.00
R7957:Klhl6	UTSW	16	19949451	missense	probably null	1.00
R8319:Klhl6	UTSW	16	19957190	missense	possibly damaging	0.74
R8460:Klhl6	UTSW	16	19957031	missense	probably damaging	1.00
R8853:Klhl6	UTSW	16	19947229	missense	possibly damaging	0.52
R9046:Klhl6	UTSW	16	19947053	missense	probably damaging	1.00
R9160:Klhl6	UTSW	16	19957022	missense	probably damaging	1.00
Z1176:Klhl6	UTSW	16	19953674	missense	probably damaging	1.00
Z1177:Klhl6	UTSW	16	19982961	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTGGACAAGAGTCCCTGGATAATGC -3'
(R):5'- TGGCAGACACACATTCTTTGGACAG -3'

Sequencing Primer
(F):5'- AGAGTCCCTGGATAATGCCTTAC -3'
(R):5'- TGGACAGTTTAAAGATGCAAGTC -3'

Posted On

2013-06-12