Incidental Mutation 'R0540:Dlg1'
ID49866
Institutional Source Beutler Lab
Gene Symbol Dlg1
Ensembl Gene ENSMUSG00000022770
Gene Namediscs large MAGUK scaffold protein 1
SynonymsDlgh1, B130052P05Rik, SAP97
MMRRC Submission 038732-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0540 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location31663443-31875129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31838174 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 596 (V596I)
Ref Sequence ENSEMBL: ENSMUSP00000023454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023454] [ENSMUST00000064477] [ENSMUST00000100001] [ENSMUST00000115196] [ENSMUST00000115201] [ENSMUST00000115205] [ENSMUST00000132176]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023454
AA Change: V596I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023454
Gene: ENSMUSG00000022770
AA Change: V596I

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 190 4.33e-44 SMART
PDZ 199 278 5.98e-22 SMART
PDZ 294 373 1.94e-21 SMART
PDZ 441 514 1.84e-22 SMART
low complexity region 534 542 N/A INTRINSIC
SH3 551 617 1.27e-9 SMART
GuKc 681 860 1.54e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000064477
AA Change: V629I

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064280
Gene: ENSMUSG00000022770
AA Change: V629I

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 736 915 1.54e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100001
AA Change: V629I

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097581
Gene: ENSMUSG00000022770
AA Change: V629I

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 714 893 1.54e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115196
AA Change: V546I

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110850
Gene: ENSMUSG00000022770
AA Change: V546I

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
MAGUK_N_PEST 30 140 1.81e-14 SMART
PDZ 149 228 5.98e-22 SMART
PDZ 244 323 1.94e-21 SMART
PDZ 391 464 1.84e-22 SMART
low complexity region 484 492 N/A INTRINSIC
SH3 501 567 1.27e-9 SMART
GuKc 643 822 1.54e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115201
AA Change: V629I

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110855
Gene: ENSMUSG00000022770
AA Change: V629I

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 721 900 1.54e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115205
AA Change: V629I

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110859
Gene: ENSMUSG00000022770
AA Change: V629I

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 714 893 1.54e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130920
Predicted Effect unknown
Transcript: ENSMUST00000131136
AA Change: V324I
SMART Domains Protein: ENSMUSP00000115954
Gene: ENSMUSG00000022770
AA Change: V324I

DomainStartEndE-ValueType
PDZ 38 117 1.94e-21 SMART
PDZ 170 243 1.84e-22 SMART
low complexity region 263 271 N/A INTRINSIC
SH3 280 346 1.27e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132176
SMART Domains Protein: ENSMUSP00000138782
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 190 4.33e-44 SMART
PDZ 199 278 5.98e-22 SMART
PDZ 294 373 1.94e-21 SMART
PDZ 426 499 1.84e-22 SMART
low complexity region 519 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147382
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain scaffolding protein that is required for normal development. This protein may have a role in septate junction formation, signal transduction, cell proliferation, synaptogenesis and lymphocyte activation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene, but the full-length nature of some of the variants is not known. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal lethality, craniofacial defects, and abnormal eye morphology. Mice homozygous for knock-out alleles exhibit neonatal lethality, kidney defects, reproductive organ morphology, and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A G 3: 60,019,206 T199A possibly damaging Het
Als2cl C A 9: 110,895,784 Y775* probably null Het
Ankhd1 G T 18: 36,640,280 V59F probably damaging Het
Ano4 T A 10: 89,023,944 I395F probably benign Het
Apcdd1 A G 18: 62,951,896 N388S possibly damaging Het
Arl9 A G 5: 77,007,271 Y83C possibly damaging Het
Armc2 T A 10: 41,922,695 H706L probably benign Het
Arrb1 T C 7: 99,588,196 probably null Het
Atxn1 G A 13: 45,557,530 S642L probably damaging Het
Bmp8a A G 4: 123,315,930 Y322H probably damaging Het
Btbd3 C T 2: 138,283,816 R307W possibly damaging Het
C1galt1 T C 6: 7,871,193 I343T probably benign Het
Capn2 A T 1: 182,492,184 Y146* probably null Het
Ccdc42 C T 11: 68,597,710 Q312* probably null Het
Cd209e T C 8: 3,851,265 K130E probably benign Het
Chd3 T C 11: 69,344,358 D2054G probably damaging Het
Chrna1 T C 2: 73,571,471 N161S probably damaging Het
Clp1 C T 2: 84,725,591 A182T possibly damaging Het
Cpsf7 G T 19: 10,533,318 E135* probably null Het
Csf2rb2 T C 15: 78,287,908 Y325C probably benign Het
Cspg5 T C 9: 110,247,392 probably null Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cyp2b13 G A 7: 26,081,711 V183I probably benign Het
D430041D05Rik C T 2: 104,233,445 R1354H probably damaging Het
Ddx24 A G 12: 103,419,067 Y426H possibly damaging Het
Dexi G T 16: 10,542,562 Y43* probably null Het
Dnah11 A C 12: 118,082,511 W1731G probably damaging Het
Dnhd1 T A 7: 105,720,788 N4473K probably benign Het
Dync2h1 A C 9: 7,051,480 S3152A probably benign Het
Edn3 C A 2: 174,760,974 P3Q probably damaging Het
Eif2a G A 3: 58,555,652 probably null Het
Emb G A 13: 117,232,750 V56I possibly damaging Het
Enpp4 A T 17: 44,099,495 C397S probably damaging Het
Exo5 A G 4: 120,921,981 V229A probably damaging Het
Fga G A 3: 83,028,562 G32E probably damaging Het
Fkbpl T C 17: 34,645,359 F34L probably benign Het
Fsd2 T A 7: 81,545,017 D466V probably damaging Het
Gcn1l1 T C 5: 115,588,956 V624A probably benign Het
Git2 A G 5: 114,748,274 F336L probably damaging Het
Greb1 T A 12: 16,682,193 Y1589F probably damaging Het
H2-K1 G T 17: 33,999,500 D127E probably damaging Het
Ints8 A G 4: 11,252,926 V52A possibly damaging Het
Kifc1 G A 17: 33,886,647 T62I probably damaging Het
Klhl6 C A 16: 19,957,014 D265Y possibly damaging Het
Kmt5a T A 5: 124,451,310 N190K probably damaging Het
Lce6a A T 3: 92,620,328 H57Q probably benign Het
Lipo3 A T 19: 33,559,567 I251K possibly damaging Het
Lnpep A T 17: 17,538,554 F843I probably damaging Het
Lrrc45 C T 11: 120,715,162 R99* probably null Het
Lrrtm1 C A 6: 77,244,628 A356E probably damaging Het
Map3k1 A C 13: 111,763,510 H493Q probably benign Het
Mcm4 A T 16: 15,632,115 probably null Het
Mkl2 A G 16: 13,381,601 E106G probably damaging Het
Mllt3 G A 4: 87,841,044 P256S possibly damaging Het
Myo7a T A 7: 98,071,946 T1271S probably damaging Het
Ncan C A 8: 70,115,159 R101L possibly damaging Het
Ndufaf7 A G 17: 78,946,456 D361G probably benign Het
Neurod6 C T 6: 55,679,587 A22T probably benign Het
Nexn T A 3: 152,248,242 K192* probably null Het
Nipsnap2 A T 5: 129,754,845 Y234F probably damaging Het
Nlrp10 T C 7: 108,924,285 K663E probably benign Het
Nprl2 A T 9: 107,545,298 Y329F possibly damaging Het
Nr2f2 C A 7: 70,354,712 R264L probably damaging Het
Nsun7 A T 5: 66,283,634 K366I probably damaging Het
Nup35 T A 2: 80,642,640 M19K probably benign Het
Olfr1364 T A 13: 21,573,778 Y226F probably benign Het
Olfr1378 C A 11: 50,969,843 A275D possibly damaging Het
Olfr17 T A 7: 107,097,726 I87K probably benign Het
Olfr266 A T 3: 106,822,513 F15L probably damaging Het
Olfr312 T A 11: 58,831,972 S273T probably damaging Het
Olfr470 A G 7: 107,845,569 S55P probably damaging Het
Olfr56 C G 11: 49,134,722 H177D probably damaging Het
Patl2 T C 2: 122,126,669 Y128C probably benign Het
Pcdhac2 A G 18: 37,145,889 I641V probably benign Het
Peli3 T C 19: 4,941,911 M1V probably null Het
Pex16 T A 2: 92,375,637 L25* probably null Het
Plekhn1 C A 4: 156,222,747 A449S possibly damaging Het
Pot1b A T 17: 55,665,765 I469N probably damaging Het
Prdx6 A C 1: 161,251,103 L5W probably damaging Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Prss38 T C 11: 59,375,543 S30G possibly damaging Het
Rgs6 C A 12: 83,059,804 Y151* probably null Het
Ripk4 A C 16: 97,744,175 L361R probably damaging Het
Serpinb3d C T 1: 107,079,232 D249N probably benign Het
Skint10 A T 4: 112,773,027 probably null Het
Smg7 A T 1: 152,855,962 N349K probably benign Het
Sohlh2 C A 3: 55,207,683 S363Y probably damaging Het
Srsf10 A G 4: 135,863,868 T210A possibly damaging Het
Synpo2l A T 14: 20,660,680 M624K probably damaging Het
Thsd7a T A 6: 12,331,542 probably null Het
Tnc A T 4: 64,020,455 V49E probably damaging Het
Tnik A C 3: 28,650,159 K989T probably damaging Het
Tnxb T A 17: 34,671,918 Y412N probably damaging Het
Trmt44 A G 5: 35,568,759 probably null Het
Tsc2 A T 17: 24,621,712 V391E probably damaging Het
Ttll5 T C 12: 85,933,676 probably null Het
Usp28 A G 9: 49,024,060 I104V probably benign Het
Vmn1r64 A G 7: 5,884,097 L149S probably damaging Het
Yme1l1 T A 2: 23,192,515 M506K possibly damaging Het
Zfp280d T A 9: 72,307,965 F98I probably damaging Het
Zfp62 C A 11: 49,215,400 T106K probably benign Het
Other mutations in Dlg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Dlg1 APN 16 31856438 splice site probably benign
IGL02277:Dlg1 APN 16 31790264 missense probably damaging 1.00
IGL02897:Dlg1 APN 16 31771856 critical splice donor site probably null
IGL03025:Dlg1 APN 16 31805727 missense probably benign 0.00
IGL03271:Dlg1 APN 16 31857892 missense possibly damaging 0.94
PIT4812001:Dlg1 UTSW 16 31846885 missense probably benign 0.01
R0068:Dlg1 UTSW 16 31836200 unclassified probably benign
R0115:Dlg1 UTSW 16 31805690 nonsense probably null
R0128:Dlg1 UTSW 16 31858065 critical splice donor site probably null
R0257:Dlg1 UTSW 16 31842853 splice site probably benign
R0268:Dlg1 UTSW 16 31684193 missense probably benign
R0312:Dlg1 UTSW 16 31790267 missense probably benign
R0321:Dlg1 UTSW 16 31858036 missense probably damaging 1.00
R0355:Dlg1 UTSW 16 31684174 nonsense probably null
R0538:Dlg1 UTSW 16 31796864 critical splice acceptor site probably null
R0607:Dlg1 UTSW 16 31665580 missense probably benign 0.37
R0607:Dlg1 UTSW 16 31838174 missense possibly damaging 0.90
R0894:Dlg1 UTSW 16 31743147 missense probably benign 0.03
R1107:Dlg1 UTSW 16 31846916 missense probably benign 0.00
R1349:Dlg1 UTSW 16 31812820 missense probably damaging 1.00
R1372:Dlg1 UTSW 16 31812820 missense probably damaging 1.00
R1468:Dlg1 UTSW 16 31842822 splice site probably null
R1468:Dlg1 UTSW 16 31842822 splice site probably null
R1696:Dlg1 UTSW 16 31781798 missense probably damaging 0.96
R1772:Dlg1 UTSW 16 31665667 missense possibly damaging 0.75
R1795:Dlg1 UTSW 16 31743147 missense probably benign 0.03
R2106:Dlg1 UTSW 16 31812756 missense probably damaging 1.00
R2206:Dlg1 UTSW 16 31853846 missense probably benign 0.18
R2207:Dlg1 UTSW 16 31853846 missense probably benign 0.18
R2846:Dlg1 UTSW 16 31863197 missense probably damaging 1.00
R3954:Dlg1 UTSW 16 31858008 missense probably damaging 1.00
R4714:Dlg1 UTSW 16 31790261 missense probably damaging 1.00
R4758:Dlg1 UTSW 16 31791752 missense possibly damaging 0.92
R4898:Dlg1 UTSW 16 31857946 missense probably damaging 1.00
R4964:Dlg1 UTSW 16 31754808 missense probably benign 0.21
R4966:Dlg1 UTSW 16 31754808 missense probably benign 0.21
R4985:Dlg1 UTSW 16 31788135 splice site probably null
R5068:Dlg1 UTSW 16 31684295 critical splice donor site probably null
R5069:Dlg1 UTSW 16 31684295 critical splice donor site probably null
R5078:Dlg1 UTSW 16 31856469 nonsense probably null
R5090:Dlg1 UTSW 16 31838084 missense probably damaging 1.00
R5225:Dlg1 UTSW 16 31836267 missense probably benign 0.21
R5888:Dlg1 UTSW 16 31791886 critical splice donor site probably null
R5950:Dlg1 UTSW 16 31665583 missense probably damaging 1.00
R6029:Dlg1 UTSW 16 31793570 missense probably damaging 1.00
R6132:Dlg1 UTSW 16 31836241 missense possibly damaging 0.93
R6246:Dlg1 UTSW 16 31665650 missense probably benign 0.00
R6294:Dlg1 UTSW 16 31838124 missense probably damaging 1.00
R6322:Dlg1 UTSW 16 31856479 missense probably damaging 1.00
R7147:Dlg1 UTSW 16 31791854 missense probably benign
R7216:Dlg1 UTSW 16 31796918 frame shift probably null
R7963:Dlg1 UTSW 16 31790301 missense probably null 0.92
R7985:Dlg1 UTSW 16 31788105 nonsense probably null
R8041:Dlg1 UTSW 16 31838067 missense possibly damaging 0.91
R8111:Dlg1 UTSW 16 31842802 missense possibly damaging 0.79
X0021:Dlg1 UTSW 16 31665708 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTCAACACAGCAATTCCCAGTCTCA -3'
(R):5'- cacacacacacccacCCATAGTTT -3'

Sequencing Primer
(F):5'- CTTAGACTGTTTCCATTACAGAGTG -3'
(R):5'- ccaacatctccccattcctc -3'
Posted On2013-06-12