Incidental Mutation 'R0541:Atp11b'
ID 49897
Institutional Source Beutler Lab
Gene Symbol Atp11b
Ensembl Gene ENSMUSG00000037400
Gene Name ATPase, class VI, type 11B
Synonyms 1110019I14Rik
MMRRC Submission 038733-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock # R0541 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 35754106-35856276 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 35806944 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 193 (D193E)
Ref Sequence ENSEMBL: ENSMUSP00000142676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029257] [ENSMUST00000198599]
AlphaFold Q6DFW5
Predicted Effect probably damaging
Transcript: ENSMUST00000029257
AA Change: D393E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400
AA Change: D393E

Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196965
Predicted Effect probably damaging
Transcript: ENSMUST00000198599
AA Change: D193E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400
AA Change: D193E

low complexity region 90 107 N/A INTRINSIC
Pfam:Hydrolase 201 632 3e-17 PFAM
Pfam:HAD 204 629 4e-16 PFAM
Pfam:Hydrolase_like2 292 405 1.2e-13 PFAM
low complexity region 833 848 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000199892
AA Change: D250E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200445
Meta Mutation Damage Score 0.1369 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,143 M115V probably benign Het
Abca7 C T 10: 80,007,351 A1220V probably benign Het
Adamts19 G A 18: 58,927,300 probably null Het
Agbl1 G A 7: 76,409,245 V194M probably benign Het
Arhgap20 G T 9: 51,849,663 S902I probably damaging Het
B3gntl1 A T 11: 121,644,604 probably benign Het
C2cd2 T C 16: 97,922,296 E7G possibly damaging Het
Camta2 A G 11: 70,681,621 L259P probably benign Het
Ccni T C 5: 93,187,704 N192D probably benign Het
Cgnl1 A G 9: 71,651,253 I946T possibly damaging Het
Chil3 T C 3: 106,161,232 probably null Het
Cntn5 A G 9: 9,673,402 probably benign Het
Cpn2 C T 16: 30,259,351 G511S possibly damaging Het
Dagla C A 19: 10,254,806 probably null Het
Dcc T C 18: 71,259,015 N1440S probably damaging Het
Drosha T A 15: 12,907,388 N1069K probably benign Het
Edc4 A G 8: 105,889,428 T812A probably benign Het
Eml4 A G 17: 83,440,042 I238V probably benign Het
Ep400 T C 5: 110,705,016 T1288A unknown Het
Fastkd1 A C 2: 69,702,406 L539R probably damaging Het
Fbln7 G A 2: 128,877,534 probably benign Het
Fbxo39 A G 11: 72,318,471 I386V probably benign Het
Gm17430 T C 18: 9,726,267 K135R probably damaging Het
Gm3646 T A 1: 39,804,323 T8S unknown Het
Gtsf1 A T 15: 103,421,192 V100E possibly damaging Het
Helz2 A G 2: 181,234,825 F1292S possibly damaging Het
Igf2bp3 G A 6: 49,107,467 probably benign Het
Ip6k2 T G 9: 108,804,627 D252E probably damaging Het
Iqck T A 7: 118,915,594 L232Q probably damaging Het
Kif18b A G 11: 102,915,175 V186A probably damaging Het
Klhl6 T A 16: 19,949,447 probably null Het
Lao1 C T 4: 118,963,802 T75I probably benign Het
Lyst T C 13: 13,681,293 F2400L probably benign Het
Map3k9 A T 12: 81,734,223 S388T possibly damaging Het
Mmp11 G T 10: 75,926,933 H229N probably damaging Het
Myh7 T G 14: 54,974,701 I1529L probably benign Het
Nckap5 G T 1: 126,695,722 D11E possibly damaging Het
Ncoa1 A T 12: 4,323,033 F123I probably damaging Het
Nelfb A T 2: 25,203,980 D385E probably benign Het
Obscn C T 11: 59,081,984 V2288M probably damaging Het
Olfr1428 C T 19: 12,109,520 V9M possibly damaging Het
Olfr1445 A G 19: 12,884,094 Y71C probably damaging Het
Olfr38 A G 6: 42,762,220 H56R probably damaging Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Otog T A 7: 46,269,249 probably benign Het
Oxa1l A G 14: 54,368,189 E375G possibly damaging Het
Pan2 T A 10: 128,308,222 I129K possibly damaging Het
Parp1 A G 1: 180,599,051 I919M probably benign Het
Pnpla7 T C 2: 24,995,293 Y174H probably damaging Het
Polr3b T C 10: 84,638,064 F169S probably damaging Het
Rab10 T C 12: 3,264,743 D45G probably damaging Het
Reln A G 5: 21,980,109 S1537P possibly damaging Het
Sema6d T A 2: 124,665,277 S1045T probably benign Het
Setd2 T C 9: 110,573,673 V1794A probably damaging Het
Spidr T A 16: 15,915,365 I589F probably damaging Het
Stmn4 A C 14: 66,357,939 I165L probably benign Het
Stx5a T C 19: 8,749,937 M177T probably damaging Het
Tll1 T C 8: 64,038,452 probably null Het
Tmem192 T C 8: 64,964,260 Y168H probably damaging Het
Ttc21a C T 9: 119,956,826 probably benign Het
Ush2a A G 1: 188,714,466 probably benign Het
Vezf1 A G 11: 88,081,577 M255V possibly damaging Het
Vmn2r25 A G 6: 123,839,827 F265S probably damaging Het
Vps13a A G 19: 16,704,577 S1021P probably benign Het
Wfdc16 T C 2: 164,635,853 E92G possibly damaging Het
Zkscan2 T C 7: 123,480,200 T845A possibly damaging Het
Other mutations in Atp11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp11b APN 3 35809376 splice site probably null
IGL00722:Atp11b APN 3 35819935 missense probably damaging 1.00
IGL00725:Atp11b APN 3 35827073 missense probably damaging 0.97
IGL01514:Atp11b APN 3 35836981 missense probably damaging 1.00
IGL01532:Atp11b APN 3 35849502 nonsense probably null
IGL01789:Atp11b APN 3 35789592 missense possibly damaging 0.81
IGL01915:Atp11b APN 3 35831463 missense probably damaging 1.00
IGL02009:Atp11b APN 3 35814152 missense probably benign 0.07
IGL02049:Atp11b APN 3 35800493 missense probably damaging 0.99
IGL02952:Atp11b APN 3 35828695 missense probably damaging 1.00
IGL02991:Atp11b UTSW 3 35826991 missense probably benign 0.00
R0044:Atp11b UTSW 3 35812252 missense probably damaging 0.99
R0254:Atp11b UTSW 3 35812110 missense possibly damaging 0.82
R0538:Atp11b UTSW 3 35837014 missense probably damaging 1.00
R0653:Atp11b UTSW 3 35839194 missense probably damaging 0.99
R0790:Atp11b UTSW 3 35832923 missense probably damaging 1.00
R1083:Atp11b UTSW 3 35778013 splice site probably benign
R1371:Atp11b UTSW 3 35806769 missense probably damaging 0.97
R1458:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R1875:Atp11b UTSW 3 35839147 missense probably damaging 1.00
R1921:Atp11b UTSW 3 35834325 missense probably damaging 1.00
R2008:Atp11b UTSW 3 35855122 missense probably damaging 0.97
R2065:Atp11b UTSW 3 35839074 missense probably damaging 1.00
R2112:Atp11b UTSW 3 35837528 missense probably damaging 1.00
R2228:Atp11b UTSW 3 35806942 missense probably damaging 1.00
R2270:Atp11b UTSW 3 35810134 splice site probably null
R2273:Atp11b UTSW 3 35828613 missense probably benign 0.04
R2439:Atp11b UTSW 3 35814084 missense possibly damaging 0.68
R2497:Atp11b UTSW 3 35855145 missense probably damaging 0.99
R4181:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R4181:Atp11b UTSW 3 35800565 missense probably benign 0.19
R4714:Atp11b UTSW 3 35834394 missense probably benign 0.02
R4923:Atp11b UTSW 3 35835379 critical splice donor site probably null
R4937:Atp11b UTSW 3 35807008 splice site probably null
R5013:Atp11b UTSW 3 35834383 missense possibly damaging 0.66
R5058:Atp11b UTSW 3 35809361 missense probably benign 0.41
R5171:Atp11b UTSW 3 35832937 missense probably damaging 1.00
R5200:Atp11b UTSW 3 35837007 missense probably benign 0.21
R5465:Atp11b UTSW 3 35810184 missense probably benign 0.00
R5651:Atp11b UTSW 3 35855140 missense probably damaging 1.00
R5689:Atp11b UTSW 3 35834352 missense possibly damaging 0.67
R5718:Atp11b UTSW 3 35837516 missense probably benign 0.12
R5807:Atp11b UTSW 3 35812279 missense probably damaging 1.00
R5888:Atp11b UTSW 3 35837547 missense probably benign 0.15
R6059:Atp11b UTSW 3 35814177 missense possibly damaging 0.72
R6259:Atp11b UTSW 3 35806901 missense probably damaging 1.00
R6359:Atp11b UTSW 3 35778061 missense probably benign 0.04
R6367:Atp11b UTSW 3 35784537 missense probably damaging 1.00
R6577:Atp11b UTSW 3 35839162 missense probably damaging 0.99
R6818:Atp11b UTSW 3 35814180 missense possibly damaging 0.71
R7016:Atp11b UTSW 3 35841036 missense probably benign
R7178:Atp11b UTSW 3 35819950 missense probably benign 0.34
R7614:Atp11b UTSW 3 35810110 splice site probably null
R7729:Atp11b UTSW 3 35778107 missense probably damaging 0.97
R7910:Atp11b UTSW 3 35831503 missense possibly damaging 0.68
R7967:Atp11b UTSW 3 35841043 missense probably benign 0.03
R8085:Atp11b UTSW 3 35841036 missense probably benign
R8095:Atp11b UTSW 3 35834416 missense probably damaging 1.00
R8499:Atp11b UTSW 3 35810705 missense probably benign 0.01
R8672:Atp11b UTSW 3 35819917 missense probably benign 0.19
R9047:Atp11b UTSW 3 35806889 missense probably damaging 0.98
R9065:Atp11b UTSW 3 35832982 critical splice donor site probably null
Z1088:Atp11b UTSW 3 35812213 missense probably damaging 1.00
Z1177:Atp11b UTSW 3 35806854 missense probably benign 0.17
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcatatccaatgcaaacgctc -3'
Posted On 2013-06-12