Incidental Mutation 'R0541:Dcc'
Institutional Source Beutler Lab
Gene Symbol Dcc
Ensembl Gene ENSMUSG00000060534
Gene Namedeleted in colorectal carcinoma
SynonymsC030036D22Rik, Igdcc1
MMRRC Submission 038733-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0541 (G1)
Quality Score225
Status Validated
Chromosomal Location71258738-72351069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71259015 bp
Amino Acid Change Asparagine to Serine at position 1440 (N1440S)
Ref Sequence ENSEMBL: ENSMUSP00000110593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073379] [ENSMUST00000114943]
Predicted Effect probably damaging
Transcript: ENSMUST00000073379
AA Change: N1420S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073094
Gene: ENSMUSG00000060534
AA Change: N1420S

transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 824 909 2.48e-6 SMART
FN3 925 1011 1.35e-7 SMART
transmembrane domain 1079 1101 N/A INTRINSIC
Pfam:Neogenin_C 1126 1425 5.5e-129 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114943
AA Change: N1440S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110593
Gene: ENSMUSG00000060534
AA Change: N1440S

transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 844 929 2.48e-6 SMART
FN3 945 1031 1.35e-7 SMART
transmembrane domain 1099 1121 N/A INTRINSIC
Pfam:Neogenin_C 1148 1445 3.4e-113 PFAM
Meta Mutation Damage Score 0.3864 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a netrin 1 receptor. The transmembrane protein is a member of the immunoglobulin superfamily of cell adhesion molecules, and mediates axon guidance of neuronal growth cones towards sources of netrin 1 ligand. The cytoplasmic tail interacts with the tyrosine kinases Src and focal adhesion kinase (FAK, also known as PTK2) to mediate axon attraction. The protein partially localizes to lipid rafts, and induces apoptosis in the absence of ligand. The protein functions as a tumor suppressor, and is frequently mutated or downregulated in colorectal cancer and esophageal carcinoma. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous animals show defects in axonal projections and hypothalamic development affecting both visual and neruoendocrine systems. Incidence of tumors increases in mutations preventing netrin-1 binding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,143 M115V probably benign Het
Abca7 C T 10: 80,007,351 A1220V probably benign Het
Adamts19 G A 18: 58,927,300 probably null Het
Agbl1 G A 7: 76,409,245 V194M probably benign Het
Arhgap20 G T 9: 51,849,663 S902I probably damaging Het
Atp11b T G 3: 35,806,944 D193E probably damaging Het
B3gntl1 A T 11: 121,644,604 probably benign Het
C2cd2 T C 16: 97,922,296 E7G possibly damaging Het
Camta2 A G 11: 70,681,621 L259P probably benign Het
Ccni T C 5: 93,187,704 N192D probably benign Het
Cgnl1 A G 9: 71,651,253 I946T possibly damaging Het
Chil3 T C 3: 106,161,232 probably null Het
Cntn5 A G 9: 9,673,402 probably benign Het
Cpn2 C T 16: 30,259,351 G511S possibly damaging Het
Dagla C A 19: 10,254,806 probably null Het
Drosha T A 15: 12,907,388 N1069K probably benign Het
Edc4 A G 8: 105,889,428 T812A probably benign Het
Eml4 A G 17: 83,440,042 I238V probably benign Het
Ep400 T C 5: 110,705,016 T1288A unknown Het
Fastkd1 A C 2: 69,702,406 L539R probably damaging Het
Fbln7 G A 2: 128,877,534 probably benign Het
Fbxo39 A G 11: 72,318,471 I386V probably benign Het
Gm17430 T C 18: 9,726,267 K135R probably damaging Het
Gm3646 T A 1: 39,804,323 T8S unknown Het
Gtsf1 A T 15: 103,421,192 V100E possibly damaging Het
Helz2 A G 2: 181,234,825 F1292S possibly damaging Het
Igf2bp3 G A 6: 49,107,467 probably benign Het
Ip6k2 T G 9: 108,804,627 D252E probably damaging Het
Iqck T A 7: 118,915,594 L232Q probably damaging Het
Kif18b A G 11: 102,915,175 V186A probably damaging Het
Klhl6 T A 16: 19,949,447 probably null Het
Lao1 C T 4: 118,963,802 T75I probably benign Het
Lyst T C 13: 13,681,293 F2400L probably benign Het
Map3k9 A T 12: 81,734,223 S388T possibly damaging Het
Mmp11 G T 10: 75,926,933 H229N probably damaging Het
Myh7 T G 14: 54,974,701 I1529L probably benign Het
Nckap5 G T 1: 126,695,722 D11E possibly damaging Het
Ncoa1 A T 12: 4,323,033 F123I probably damaging Het
Nelfb A T 2: 25,203,980 D385E probably benign Het
Obscn C T 11: 59,081,984 V2288M probably damaging Het
Olfr1428 C T 19: 12,109,520 V9M possibly damaging Het
Olfr1445 A G 19: 12,884,094 Y71C probably damaging Het
Olfr38 A G 6: 42,762,220 H56R probably damaging Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Otog T A 7: 46,269,249 probably benign Het
Oxa1l A G 14: 54,368,189 E375G possibly damaging Het
Pan2 T A 10: 128,308,222 I129K possibly damaging Het
Parp1 A G 1: 180,599,051 I919M probably benign Het
Pnpla7 T C 2: 24,995,293 Y174H probably damaging Het
Polr3b T C 10: 84,638,064 F169S probably damaging Het
Rab10 T C 12: 3,264,743 D45G probably damaging Het
Reln A G 5: 21,980,109 S1537P possibly damaging Het
Sema6d T A 2: 124,665,277 S1045T probably benign Het
Setd2 T C 9: 110,573,673 V1794A probably damaging Het
Spidr T A 16: 15,915,365 I589F probably damaging Het
Stmn4 A C 14: 66,357,939 I165L probably benign Het
Stx5a T C 19: 8,749,937 M177T probably damaging Het
Tll1 T C 8: 64,038,452 probably null Het
Tmem192 T C 8: 64,964,260 Y168H probably damaging Het
Ttc21a C T 9: 119,956,826 probably benign Het
Ush2a A G 1: 188,714,466 probably benign Het
Vezf1 A G 11: 88,081,577 M255V possibly damaging Het
Vmn2r25 A G 6: 123,839,827 F265S probably damaging Het
Vps13a A G 19: 16,704,577 S1021P probably benign Het
Wfdc16 T C 2: 164,635,853 E92G possibly damaging Het
Zkscan2 T C 7: 123,480,200 T845A possibly damaging Het
Other mutations in Dcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dcc APN 18 71384225 critical splice acceptor site probably null
IGL00781:Dcc APN 18 71809195 missense probably benign 0.25
IGL00818:Dcc APN 18 71955012 missense probably benign
IGL00895:Dcc APN 18 71810800 missense probably damaging 0.98
IGL00969:Dcc APN 18 71456883 missense probably benign 0.25
IGL01019:Dcc APN 18 71809090 missense probably benign 0.00
IGL01132:Dcc APN 18 71682174 nonsense probably null
IGL01349:Dcc APN 18 71370737 missense probably damaging 1.00
IGL01355:Dcc APN 18 71809114 missense probably benign 0.00
IGL01374:Dcc APN 18 71374553 missense probably damaging 1.00
IGL01947:Dcc APN 18 71826209 missense probably benign
IGL02470:Dcc APN 18 71955082 splice site probably benign
IGL02508:Dcc APN 18 71370702 missense probably benign 0.00
IGL02999:Dcc APN 18 71378678 missense possibly damaging 0.68
IGL03034:Dcc APN 18 71575143 nonsense probably null
IGL03118:Dcc APN 18 71420273 missense probably benign 0.00
IGL03133:Dcc APN 18 71262955 splice site probably benign
IGL03357:Dcc APN 18 71327554 missense probably damaging 1.00
Hyperrev UTSW 18 71259015 missense probably damaging 1.00
LCD18:Dcc UTSW 18 72297447 intron probably benign
P0031:Dcc UTSW 18 71384228 splice site probably benign
PIT4142001:Dcc UTSW 18 71384226 splice site probably null
R0076:Dcc UTSW 18 71321046 nonsense probably null
R0355:Dcc UTSW 18 71575208 missense possibly damaging 0.75
R0370:Dcc UTSW 18 71587985 missense possibly damaging 0.92
R0383:Dcc UTSW 18 71420263 missense probably damaging 0.99
R0690:Dcc UTSW 18 71809204 splice site probably benign
R0762:Dcc UTSW 18 71342705 splice site probably benign
R0765:Dcc UTSW 18 71362990 missense probably damaging 1.00
R0846:Dcc UTSW 18 71826212 missense probably benign 0.06
R1230:Dcc UTSW 18 71682313 missense probably damaging 1.00
R1662:Dcc UTSW 18 71420338 missense probably benign 0.00
R1663:Dcc UTSW 18 71826052 missense probably damaging 1.00
R1697:Dcc UTSW 18 71370737 missense probably damaging 1.00
R1770:Dcc UTSW 18 71446399 missense probably benign 0.01
R1781:Dcc UTSW 18 71378717 missense probably benign 0.41
R1797:Dcc UTSW 18 71367161 missense probably damaging 1.00
R2101:Dcc UTSW 18 71810870 missense possibly damaging 0.62
R2190:Dcc UTSW 18 71547420 missense possibly damaging 0.89
R2248:Dcc UTSW 18 71826168 missense probably benign 0.00
R2262:Dcc UTSW 18 71374551 missense probably damaging 1.00
R2442:Dcc UTSW 18 71456883 missense probably damaging 0.98
R3844:Dcc UTSW 18 71826186 missense probably benign 0.01
R4037:Dcc UTSW 18 72350397 missense possibly damaging 0.57
R4085:Dcc UTSW 18 71826169 missense probably benign 0.00
R4344:Dcc UTSW 18 71374490 missense probably damaging 0.99
R4499:Dcc UTSW 18 71547317 missense probably benign 0.07
R4611:Dcc UTSW 18 71548998 splice site probably null
R4811:Dcc UTSW 18 71299483 missense probably benign 0.31
R4937:Dcc UTSW 18 71542249 nonsense probably null
R5125:Dcc UTSW 18 71456877 missense probably benign 0.02
R5292:Dcc UTSW 18 71306088 missense probably damaging 1.00
R5297:Dcc UTSW 18 71378738 missense probably benign 0.00
R5317:Dcc UTSW 18 71384155 missense possibly damaging 0.78
R5691:Dcc UTSW 18 71575083 missense probably damaging 1.00
R5693:Dcc UTSW 18 71575082 missense probably damaging 1.00
R6091:Dcc UTSW 18 71809114 missense probably benign 0.00
R6291:Dcc UTSW 18 71682167 missense probably benign 0.06
R6307:Dcc UTSW 18 71810755 missense probably benign 0.15
R6343:Dcc UTSW 18 71336035 missense probably damaging 1.00
R6508:Dcc UTSW 18 71306073 missense probably damaging 1.00
R6701:Dcc UTSW 18 71809120 missense probably benign 0.02
R6810:Dcc UTSW 18 71370693 missense probably damaging 0.99
R7078:Dcc UTSW 18 71547398 missense probably benign 0.05
R7172:Dcc UTSW 18 71378684 missense probably benign 0.04
R7345:Dcc UTSW 18 71378824 missense probably benign 0.00
R7365:Dcc UTSW 18 71826123 missense probably damaging 0.98
R7395:Dcc UTSW 18 71374569 nonsense probably null
R7455:Dcc UTSW 18 71420323 missense probably benign 0.00
R7461:Dcc UTSW 18 71306034 missense probably damaging 1.00
R7485:Dcc UTSW 18 71420246 missense probably benign 0.00
R7732:Dcc UTSW 18 71446435 missense probably benign 0.24
R7886:Dcc UTSW 18 71954868 nonsense probably null
R8097:Dcc UTSW 18 71679502 missense probably damaging 1.00
R8137:Dcc UTSW 18 71378712 missense probably benign 0.00
R8188:Dcc UTSW 18 71810857 missense probably benign
R8236:Dcc UTSW 18 71955018 missense probably benign
R8802:Dcc UTSW 18 71826054 missense probably damaging 1.00
W0251:Dcc UTSW 18 71826083 missense probably damaging 1.00
X0020:Dcc UTSW 18 71321100 missense probably damaging 0.97
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggcaccattatcatttcacagac -3'
Posted On2013-06-12