Incidental Mutation 'R0542:Dusp27'
ID49954
Institutional Source Beutler Lab
Gene Symbol Dusp27
Ensembl Gene ENSMUSG00000026564
Gene Namedual specificity phosphatase 27 (putative)
SynonymsC130085G02Rik
MMRRC Submission 038734-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0542 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location166098148-166127922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 166101284 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 253 (M253K)
Ref Sequence ENSEMBL: ENSMUSP00000141564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085992
AA Change: M253K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: M253K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192369
AA Change: M253K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: M253K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Meta Mutation Damage Score 0.1289 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,782,172 N22S probably benign Het
Abhd12b C A 12: 70,163,495 N71K possibly damaging Het
Adgrl2 A G 3: 148,859,218 I242T probably damaging Het
Adgrv1 A G 13: 81,573,318 S714P probably damaging Het
Agap3 G A 5: 24,500,186 R704Q possibly damaging Het
Ankrd11 T C 8: 122,895,770 R448G probably damaging Het
Anks1b T C 10: 90,073,967 probably benign Het
Caml A T 13: 55,623,161 Q24L possibly damaging Het
Cdc14b G A 13: 64,243,683 T124I probably benign Het
Clca2 A G 3: 145,075,810 probably benign Het
Col12a1 A G 9: 79,605,328 probably null Het
Crispld1 T C 1: 17,746,768 V183A possibly damaging Het
Dhx40 C T 11: 86,804,256 probably null Het
Dmxl1 T A 18: 49,893,694 D1956E probably benign Het
Dsc2 A G 18: 20,051,226 V35A probably damaging Het
Elovl2 A G 13: 41,191,976 probably benign Het
Gapvd1 T C 2: 34,725,036 probably benign Het
Gnaq T A 19: 16,219,618 I56N probably damaging Het
Gpr139 T C 7: 119,145,083 D93G probably benign Het
Hars C T 18: 36,771,181 R215H probably benign Het
Helz2 C A 2: 181,232,089 W2204L probably damaging Het
Itgb6 A T 2: 60,605,136 C757S possibly damaging Het
Kpnb1 G A 11: 97,187,572 T5I probably benign Het
Krt82 T C 15: 101,545,600 probably benign Het
Lgals9 T A 11: 78,969,720 K175N possibly damaging Het
Lrp2 A G 2: 69,428,654 I4564T probably benign Het
Mblac1 A G 5: 138,194,536 T47A possibly damaging Het
Med12l G A 3: 59,042,401 D182N probably damaging Het
Megf9 A G 4: 70,435,348 I407T probably benign Het
Mtmr6 A T 14: 60,292,129 probably null Het
Mtor A G 4: 148,540,450 T2173A probably benign Het
Mzt1 A T 14: 99,040,502 probably benign Het
Narf T C 11: 121,252,864 L444P probably damaging Het
Nsd1 A T 13: 55,260,458 Q1305L possibly damaging Het
Ntsr1 A G 2: 180,542,581 Y359C probably damaging Het
Olfm1 A G 2: 28,214,628 D159G possibly damaging Het
Olfr168 A T 16: 19,529,982 *313R probably null Het
Pcdh1 C T 18: 38,189,922 V953I probably damaging Het
Pcdhb11 A T 18: 37,423,834 D739V probably damaging Het
Pdgfd A G 9: 6,359,769 N280S probably damaging Het
Per2 A T 1: 91,438,332 probably null Het
Pfkp G T 13: 6,621,992 C122* probably null Het
Plxna4 G A 6: 32,192,297 R1322W probably damaging Het
Ppox A G 1: 171,279,244 L202P probably damaging Het
Ppp1r3e G A 14: 54,877,131 P58L probably benign Het
Prr23a2 A C 9: 98,857,033 N148T probably benign Het
Psd T C 19: 46,314,210 T842A probably damaging Het
Ranbp2 C T 10: 58,478,414 A1652V probably benign Het
Rragd G A 4: 33,007,103 V144M probably damaging Het
Sema6a T G 18: 47,248,576 D968A probably damaging Het
Slc30a5 A T 13: 100,809,285 probably null Het
Snx17 G T 5: 31,196,551 probably null Het
Syt14 G T 1: 192,930,803 T563K probably damaging Het
Tada3 T C 6: 113,375,214 K85E probably damaging Het
Tspear T C 10: 77,881,087 V532A probably benign Het
Ttc30b A G 2: 75,936,711 V566A probably damaging Het
Ttn A T 2: 76,893,109 C6426S possibly damaging Het
Unc79 T C 12: 103,094,178 probably benign Het
Usp19 A G 9: 108,494,385 probably null Het
Vav3 G A 3: 109,527,430 D426N probably damaging Het
Vezt T C 10: 94,007,096 probably null Het
Vldlr G T 19: 27,236,255 R114L probably benign Het
Wdr34 A G 2: 30,031,825 V508A probably damaging Het
Wwc2 C T 8: 47,868,379 V567I unknown Het
Zfp423 T C 8: 87,780,609 T911A probably damaging Het
Zfp719 A G 7: 43,589,253 probably null Het
Zkscan16 A T 4: 58,956,597 H293L possibly damaging Het
Zkscan6 A C 11: 65,828,699 N515T possibly damaging Het
Znfx1 A G 2: 167,055,655 S450P probably damaging Het
Other mutations in Dusp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Dusp27 APN 1 166100552 missense probably benign 0.00
IGL00973:Dusp27 APN 1 166099458 missense probably benign
IGL01331:Dusp27 APN 1 166108180 missense probably damaging 1.00
IGL01466:Dusp27 APN 1 166100504 missense probably damaging 1.00
IGL01572:Dusp27 APN 1 166100372 missense probably benign 0.18
IGL01906:Dusp27 APN 1 166099523 missense probably damaging 1.00
IGL01974:Dusp27 APN 1 166100536 nonsense probably null
IGL02112:Dusp27 APN 1 166099671 nonsense probably null
IGL02805:Dusp27 APN 1 166099061 missense probably damaging 1.00
IGL03343:Dusp27 APN 1 166099448 missense probably benign 0.00
R0116:Dusp27 UTSW 1 166099701 missense probably benign 0.19
R0367:Dusp27 UTSW 1 166100763 missense probably benign 0.05
R0499:Dusp27 UTSW 1 166099101 missense probably benign 0.00
R1312:Dusp27 UTSW 1 166099291 missense possibly damaging 0.46
R1572:Dusp27 UTSW 1 166099455 missense possibly damaging 0.68
R1598:Dusp27 UTSW 1 166110259 missense probably benign 0.10
R1858:Dusp27 UTSW 1 166100846 missense possibly damaging 0.87
R2021:Dusp27 UTSW 1 166100823 missense probably benign 0.00
R2970:Dusp27 UTSW 1 166099229 missense probably benign 0.04
R3727:Dusp27 UTSW 1 166099506 missense probably damaging 1.00
R4041:Dusp27 UTSW 1 166100111 missense probably benign 0.01
R4245:Dusp27 UTSW 1 166101116 missense probably damaging 1.00
R4955:Dusp27 UTSW 1 166108092 missense probably damaging 1.00
R4967:Dusp27 UTSW 1 166127106 missense probably damaging 1.00
R5040:Dusp27 UTSW 1 166100345 missense probably benign 0.17
R5342:Dusp27 UTSW 1 166110250 missense probably benign 0.01
R5467:Dusp27 UTSW 1 166112030 critical splice donor site probably null
R5742:Dusp27 UTSW 1 166099454 missense probably benign 0.00
R6222:Dusp27 UTSW 1 166098645 missense probably benign 0.26
R6239:Dusp27 UTSW 1 166098819 missense probably damaging 1.00
R6531:Dusp27 UTSW 1 166110046 splice site probably null
R6586:Dusp27 UTSW 1 166100885 missense possibly damaging 0.79
R6958:Dusp27 UTSW 1 166107996 missense probably damaging 1.00
R7006:Dusp27 UTSW 1 166099094 missense probably benign
R7111:Dusp27 UTSW 1 166127154 missense possibly damaging 0.66
R7310:Dusp27 UTSW 1 166098731 missense possibly damaging 0.46
R7312:Dusp27 UTSW 1 166127107 missense probably damaging 0.99
R7378:Dusp27 UTSW 1 166112063 nonsense probably null
R7398:Dusp27 UTSW 1 166100475 missense probably damaging 1.00
R7442:Dusp27 UTSW 1 166101015 missense probably benign 0.01
R7569:Dusp27 UTSW 1 166108035 missense probably damaging 1.00
R7920:Dusp27 UTSW 1 166099896 missense possibly damaging 0.72
R7954:Dusp27 UTSW 1 166099280 missense probably benign 0.05
R7972:Dusp27 UTSW 1 166099139 missense probably damaging 1.00
R8186:Dusp27 UTSW 1 166100079 missense probably damaging 1.00
R8354:Dusp27 UTSW 1 166108133 missense probably damaging 1.00
R8454:Dusp27 UTSW 1 166108133 missense probably damaging 1.00
R8535:Dusp27 UTSW 1 166101161 missense probably benign 0.01
Z1088:Dusp27 UTSW 1 166099283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGAATTGACTCTAGCACCCAGC -3'
(R):5'- CCCAGTGTTTCAGAAGTGACAGCAG -3'

Sequencing Primer
(F):5'- CATGCTCCCGGCATCTTC -3'
(R):5'- GGGACAAGTCCTGTGTGAC -3'
Posted On2013-06-12