Incidental Mutation 'R0542:Styxl2'
ID 49954
Institutional Source Beutler Lab
Gene Symbol Styxl2
Ensembl Gene ENSMUSG00000026564
Gene Name serine/threonine/tyrosine interacting like 2
Synonyms C130085G02Rik, Dusp27
MMRRC Submission 038734-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0542 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 165925717-165955467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 165928853 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 253 (M253K)
Ref Sequence ENSEMBL: ENSMUSP00000141564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
AlphaFold Q148W8
Predicted Effect possibly damaging
Transcript: ENSMUST00000085992
AA Change: M253K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: M253K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192369
AA Change: M253K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: M253K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Meta Mutation Damage Score 0.1289 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b C A 12: 70,210,269 (GRCm39) N71K possibly damaging Het
Adgrl2 A G 3: 148,564,854 (GRCm39) I242T probably damaging Het
Adgrv1 A G 13: 81,721,437 (GRCm39) S714P probably damaging Het
Agap3 G A 5: 24,705,184 (GRCm39) R704Q possibly damaging Het
Ankrd11 T C 8: 123,622,509 (GRCm39) R448G probably damaging Het
Anks1b T C 10: 89,909,829 (GRCm39) probably benign Het
Caml A T 13: 55,770,974 (GRCm39) Q24L possibly damaging Het
Cdc14b G A 13: 64,391,497 (GRCm39) T124I probably benign Het
Clca3a2 A G 3: 144,781,571 (GRCm39) probably benign Het
Col12a1 A G 9: 79,512,610 (GRCm39) probably null Het
Crispld1 T C 1: 17,816,992 (GRCm39) V183A possibly damaging Het
Cstdc1 A G 2: 148,624,092 (GRCm39) N22S probably benign Het
Dhx40 C T 11: 86,695,082 (GRCm39) probably null Het
Dmxl1 T A 18: 50,026,761 (GRCm39) D1956E probably benign Het
Dsc2 A G 18: 20,184,283 (GRCm39) V35A probably damaging Het
Dync2i2 A G 2: 29,921,837 (GRCm39) V508A probably damaging Het
Elovl2 A G 13: 41,345,452 (GRCm39) probably benign Het
Gapvd1 T C 2: 34,615,048 (GRCm39) probably benign Het
Gnaq T A 19: 16,196,982 (GRCm39) I56N probably damaging Het
Gpr139 T C 7: 118,744,306 (GRCm39) D93G probably benign Het
Hars1 C T 18: 36,904,234 (GRCm39) R215H probably benign Het
Helz2 C A 2: 180,873,882 (GRCm39) W2204L probably damaging Het
Ift70b A G 2: 75,767,055 (GRCm39) V566A probably damaging Het
Itgb6 A T 2: 60,435,480 (GRCm39) C757S possibly damaging Het
Kpnb1 G A 11: 97,078,398 (GRCm39) T5I probably benign Het
Krt82 T C 15: 101,454,035 (GRCm39) probably benign Het
Lgals9 T A 11: 78,860,546 (GRCm39) K175N possibly damaging Het
Lrp2 A G 2: 69,258,998 (GRCm39) I4564T probably benign Het
Mblac1 A G 5: 138,192,798 (GRCm39) T47A possibly damaging Het
Med12l G A 3: 58,949,822 (GRCm39) D182N probably damaging Het
Megf9 A G 4: 70,353,585 (GRCm39) I407T probably benign Het
Mtmr6 A T 14: 60,529,578 (GRCm39) probably null Het
Mtor A G 4: 148,624,907 (GRCm39) T2173A probably benign Het
Mzt1 A T 14: 99,277,938 (GRCm39) probably benign Het
Narf T C 11: 121,143,690 (GRCm39) L444P probably damaging Het
Nsd1 A T 13: 55,408,271 (GRCm39) Q1305L possibly damaging Het
Ntsr1 A G 2: 180,184,374 (GRCm39) Y359C probably damaging Het
Olfm1 A G 2: 28,104,640 (GRCm39) D159G possibly damaging Het
Or2l13b A T 16: 19,348,732 (GRCm39) *313R probably null Het
Pcdh1 C T 18: 38,322,975 (GRCm39) V953I probably damaging Het
Pcdhb11 A T 18: 37,556,887 (GRCm39) D739V probably damaging Het
Pdgfd A G 9: 6,359,769 (GRCm39) N280S probably damaging Het
Per2 A T 1: 91,366,054 (GRCm39) probably null Het
Pfkp G T 13: 6,672,028 (GRCm39) C122* probably null Het
Plxna4 G A 6: 32,169,232 (GRCm39) R1322W probably damaging Het
Ppox A G 1: 171,106,818 (GRCm39) L202P probably damaging Het
Ppp1r3e G A 14: 55,114,588 (GRCm39) P58L probably benign Het
Prr23a2 A C 9: 98,739,086 (GRCm39) N148T probably benign Het
Psd T C 19: 46,302,649 (GRCm39) T842A probably damaging Het
Ranbp2 C T 10: 58,314,236 (GRCm39) A1652V probably benign Het
Rragd G A 4: 33,007,103 (GRCm39) V144M probably damaging Het
Sema6a T G 18: 47,381,643 (GRCm39) D968A probably damaging Het
Slc30a5 A T 13: 100,945,793 (GRCm39) probably null Het
Snx17 G T 5: 31,353,895 (GRCm39) probably null Het
Syt14 G T 1: 192,613,111 (GRCm39) T563K probably damaging Het
Tada3 T C 6: 113,352,175 (GRCm39) K85E probably damaging Het
Tspear T C 10: 77,716,921 (GRCm39) V532A probably benign Het
Ttn A T 2: 76,723,453 (GRCm39) C6426S possibly damaging Het
Unc79 T C 12: 103,060,437 (GRCm39) probably benign Het
Usp19 A G 9: 108,371,584 (GRCm39) probably null Het
Vav3 G A 3: 109,434,746 (GRCm39) D426N probably damaging Het
Vezt T C 10: 93,842,958 (GRCm39) probably null Het
Vldlr G T 19: 27,213,655 (GRCm39) R114L probably benign Het
Wwc2 C T 8: 48,321,414 (GRCm39) V567I unknown Het
Zfp423 T C 8: 88,507,237 (GRCm39) T911A probably damaging Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Zkscan16 A T 4: 58,956,597 (GRCm39) H293L possibly damaging Het
Zkscan6 A C 11: 65,719,525 (GRCm39) N515T possibly damaging Het
Znfx1 A G 2: 166,897,575 (GRCm39) S450P probably damaging Het
Other mutations in Styxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Styxl2 APN 1 165,928,121 (GRCm39) missense probably benign 0.00
IGL00973:Styxl2 APN 1 165,927,027 (GRCm39) missense probably benign
IGL01331:Styxl2 APN 1 165,935,749 (GRCm39) missense probably damaging 1.00
IGL01466:Styxl2 APN 1 165,928,073 (GRCm39) missense probably damaging 1.00
IGL01572:Styxl2 APN 1 165,927,941 (GRCm39) missense probably benign 0.18
IGL01906:Styxl2 APN 1 165,927,092 (GRCm39) missense probably damaging 1.00
IGL01974:Styxl2 APN 1 165,928,105 (GRCm39) nonsense probably null
IGL02112:Styxl2 APN 1 165,927,240 (GRCm39) nonsense probably null
IGL02805:Styxl2 APN 1 165,926,630 (GRCm39) missense probably damaging 1.00
IGL03343:Styxl2 APN 1 165,927,017 (GRCm39) missense probably benign 0.00
R0116:Styxl2 UTSW 1 165,927,270 (GRCm39) missense probably benign 0.19
R0367:Styxl2 UTSW 1 165,928,332 (GRCm39) missense probably benign 0.05
R0499:Styxl2 UTSW 1 165,926,670 (GRCm39) missense probably benign 0.00
R1312:Styxl2 UTSW 1 165,926,860 (GRCm39) missense possibly damaging 0.46
R1572:Styxl2 UTSW 1 165,927,024 (GRCm39) missense possibly damaging 0.68
R1598:Styxl2 UTSW 1 165,937,828 (GRCm39) missense probably benign 0.10
R1858:Styxl2 UTSW 1 165,928,415 (GRCm39) missense possibly damaging 0.87
R2021:Styxl2 UTSW 1 165,928,392 (GRCm39) missense probably benign 0.00
R2970:Styxl2 UTSW 1 165,926,798 (GRCm39) missense probably benign 0.04
R3727:Styxl2 UTSW 1 165,927,075 (GRCm39) missense probably damaging 1.00
R4041:Styxl2 UTSW 1 165,927,680 (GRCm39) missense probably benign 0.01
R4245:Styxl2 UTSW 1 165,928,685 (GRCm39) missense probably damaging 1.00
R4955:Styxl2 UTSW 1 165,935,661 (GRCm39) missense probably damaging 1.00
R4967:Styxl2 UTSW 1 165,954,675 (GRCm39) missense probably damaging 1.00
R5040:Styxl2 UTSW 1 165,927,914 (GRCm39) missense probably benign 0.17
R5342:Styxl2 UTSW 1 165,937,819 (GRCm39) missense probably benign 0.01
R5467:Styxl2 UTSW 1 165,939,599 (GRCm39) critical splice donor site probably null
R5742:Styxl2 UTSW 1 165,927,023 (GRCm39) missense probably benign 0.00
R6222:Styxl2 UTSW 1 165,926,214 (GRCm39) missense probably benign 0.26
R6239:Styxl2 UTSW 1 165,926,388 (GRCm39) missense probably damaging 1.00
R6531:Styxl2 UTSW 1 165,937,615 (GRCm39) splice site probably null
R6586:Styxl2 UTSW 1 165,928,454 (GRCm39) missense possibly damaging 0.79
R6958:Styxl2 UTSW 1 165,935,565 (GRCm39) missense probably damaging 1.00
R7006:Styxl2 UTSW 1 165,926,663 (GRCm39) missense probably benign
R7111:Styxl2 UTSW 1 165,954,723 (GRCm39) missense possibly damaging 0.66
R7310:Styxl2 UTSW 1 165,926,300 (GRCm39) missense possibly damaging 0.46
R7312:Styxl2 UTSW 1 165,954,676 (GRCm39) missense probably damaging 0.99
R7378:Styxl2 UTSW 1 165,939,632 (GRCm39) nonsense probably null
R7398:Styxl2 UTSW 1 165,928,044 (GRCm39) missense probably damaging 1.00
R7442:Styxl2 UTSW 1 165,928,584 (GRCm39) missense probably benign 0.01
R7569:Styxl2 UTSW 1 165,935,604 (GRCm39) missense probably damaging 1.00
R7920:Styxl2 UTSW 1 165,927,465 (GRCm39) missense possibly damaging 0.72
R7954:Styxl2 UTSW 1 165,926,849 (GRCm39) missense probably benign 0.05
R7972:Styxl2 UTSW 1 165,926,708 (GRCm39) missense probably damaging 1.00
R8186:Styxl2 UTSW 1 165,927,648 (GRCm39) missense probably damaging 1.00
R8354:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8454:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8535:Styxl2 UTSW 1 165,928,730 (GRCm39) missense probably benign 0.01
R9419:Styxl2 UTSW 1 165,927,755 (GRCm39) missense probably damaging 1.00
R9493:Styxl2 UTSW 1 165,926,410 (GRCm39) missense probably damaging 1.00
R9694:Styxl2 UTSW 1 165,928,654 (GRCm39) missense probably damaging 1.00
Z1088:Styxl2 UTSW 1 165,926,852 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGAATTGACTCTAGCACCCAGC -3'
(R):5'- CCCAGTGTTTCAGAAGTGACAGCAG -3'

Sequencing Primer
(F):5'- CATGCTCCCGGCATCTTC -3'
(R):5'- GGGACAAGTCCTGTGTGAC -3'
Posted On 2013-06-12