Incidental Mutation 'R0542:Ttc30b'
ID49962
Institutional Source Beutler Lab
Gene Symbol Ttc30b
Ensembl Gene ENSMUSG00000075273
Gene Nametetratricopeptide repeat domain 30B
Synonyms
MMRRC Submission 038734-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0542 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location75935849-75938585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75936711 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 566 (V566A)
Ref Sequence ENSEMBL: ENSMUSP00000097576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099996]
Predicted Effect probably damaging
Transcript: ENSMUST00000099996
AA Change: V566A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097576
Gene: ENSMUSG00000075273
AA Change: V566A

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 3.89e1 SMART
TPR 187 220 6.24e1 SMART
TPR 423 456 7.49e1 SMART
Blast:TPR 457 491 3e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Meta Mutation Damage Score 0.2065 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,782,172 N22S probably benign Het
Abhd12b C A 12: 70,163,495 N71K possibly damaging Het
Adgrl2 A G 3: 148,859,218 I242T probably damaging Het
Adgrv1 A G 13: 81,573,318 S714P probably damaging Het
Agap3 G A 5: 24,500,186 R704Q possibly damaging Het
Ankrd11 T C 8: 122,895,770 R448G probably damaging Het
Anks1b T C 10: 90,073,967 probably benign Het
Caml A T 13: 55,623,161 Q24L possibly damaging Het
Cdc14b G A 13: 64,243,683 T124I probably benign Het
Clca2 A G 3: 145,075,810 probably benign Het
Col12a1 A G 9: 79,605,328 probably null Het
Crispld1 T C 1: 17,746,768 V183A possibly damaging Het
Dhx40 C T 11: 86,804,256 probably null Het
Dmxl1 T A 18: 49,893,694 D1956E probably benign Het
Dsc2 A G 18: 20,051,226 V35A probably damaging Het
Dusp27 A T 1: 166,101,284 M253K possibly damaging Het
Elovl2 A G 13: 41,191,976 probably benign Het
Gapvd1 T C 2: 34,725,036 probably benign Het
Gnaq T A 19: 16,219,618 I56N probably damaging Het
Gpr139 T C 7: 119,145,083 D93G probably benign Het
Hars C T 18: 36,771,181 R215H probably benign Het
Helz2 C A 2: 181,232,089 W2204L probably damaging Het
Itgb6 A T 2: 60,605,136 C757S possibly damaging Het
Kpnb1 G A 11: 97,187,572 T5I probably benign Het
Krt82 T C 15: 101,545,600 probably benign Het
Lgals9 T A 11: 78,969,720 K175N possibly damaging Het
Lrp2 A G 2: 69,428,654 I4564T probably benign Het
Mblac1 A G 5: 138,194,536 T47A possibly damaging Het
Med12l G A 3: 59,042,401 D182N probably damaging Het
Megf9 A G 4: 70,435,348 I407T probably benign Het
Mtmr6 A T 14: 60,292,129 probably null Het
Mtor A G 4: 148,540,450 T2173A probably benign Het
Mzt1 A T 14: 99,040,502 probably benign Het
Narf T C 11: 121,252,864 L444P probably damaging Het
Nsd1 A T 13: 55,260,458 Q1305L possibly damaging Het
Ntsr1 A G 2: 180,542,581 Y359C probably damaging Het
Olfm1 A G 2: 28,214,628 D159G possibly damaging Het
Olfr168 A T 16: 19,529,982 *313R probably null Het
Pcdh1 C T 18: 38,189,922 V953I probably damaging Het
Pcdhb11 A T 18: 37,423,834 D739V probably damaging Het
Pdgfd A G 9: 6,359,769 N280S probably damaging Het
Per2 A T 1: 91,438,332 probably null Het
Pfkp G T 13: 6,621,992 C122* probably null Het
Plxna4 G A 6: 32,192,297 R1322W probably damaging Het
Ppox A G 1: 171,279,244 L202P probably damaging Het
Ppp1r3e G A 14: 54,877,131 P58L probably benign Het
Prr23a2 A C 9: 98,857,033 N148T probably benign Het
Psd T C 19: 46,314,210 T842A probably damaging Het
Ranbp2 C T 10: 58,478,414 A1652V probably benign Het
Rragd G A 4: 33,007,103 V144M probably damaging Het
Sema6a T G 18: 47,248,576 D968A probably damaging Het
Slc30a5 A T 13: 100,809,285 probably null Het
Snx17 G T 5: 31,196,551 probably null Het
Syt14 G T 1: 192,930,803 T563K probably damaging Het
Tada3 T C 6: 113,375,214 K85E probably damaging Het
Tspear T C 10: 77,881,087 V532A probably benign Het
Ttn A T 2: 76,893,109 C6426S possibly damaging Het
Unc79 T C 12: 103,094,178 probably benign Het
Usp19 A G 9: 108,494,385 probably null Het
Vav3 G A 3: 109,527,430 D426N probably damaging Het
Vezt T C 10: 94,007,096 probably null Het
Vldlr G T 19: 27,236,255 R114L probably benign Het
Wdr34 A G 2: 30,031,825 V508A probably damaging Het
Wwc2 C T 8: 47,868,379 V567I unknown Het
Zfp423 T C 8: 87,780,609 T911A probably damaging Het
Zfp719 A G 7: 43,589,253 probably null Het
Zkscan16 A T 4: 58,956,597 H293L possibly damaging Het
Zkscan6 A C 11: 65,828,699 N515T possibly damaging Het
Znfx1 A G 2: 167,055,655 S450P probably damaging Het
Other mutations in Ttc30b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Ttc30b APN 2 75936882 missense probably damaging 1.00
IGL02565:Ttc30b APN 2 75937903 missense probably benign 0.03
IGL02891:Ttc30b APN 2 75937060 missense possibly damaging 0.88
R0383:Ttc30b UTSW 2 75938242 missense probably damaging 1.00
R1470:Ttc30b UTSW 2 75937811 missense probably benign
R1470:Ttc30b UTSW 2 75937811 missense probably benign
R1656:Ttc30b UTSW 2 75937416 missense probably benign 0.26
R1951:Ttc30b UTSW 2 75937242 missense probably damaging 1.00
R1959:Ttc30b UTSW 2 75937099 missense probably benign 0.06
R1994:Ttc30b UTSW 2 75938058 missense probably damaging 1.00
R2132:Ttc30b UTSW 2 75936785 missense probably damaging 1.00
R4968:Ttc30b UTSW 2 75938047 missense probably benign 0.00
R6110:Ttc30b UTSW 2 75937800 missense probably damaging 1.00
R6502:Ttc30b UTSW 2 75937104 missense possibly damaging 0.87
R7154:Ttc30b UTSW 2 75938061 missense possibly damaging 0.88
R7182:Ttc30b UTSW 2 75937949 nonsense probably null
R7269:Ttc30b UTSW 2 75937494 missense probably damaging 1.00
R7866:Ttc30b UTSW 2 75936619 missense possibly damaging 0.94
R7949:Ttc30b UTSW 2 75936619 missense possibly damaging 0.94
Z1088:Ttc30b UTSW 2 75937982 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACAGTGCTCTAGAAACTGCACAC -3'
(R):5'- CATGATCACTTGCCAGACAGCTCC -3'

Sequencing Primer
(F):5'- GCTCTAGAAACTGCACACATTCTTG -3'
(R):5'- AACATCCTGAGTGTCAGTGC -3'
Posted On2013-06-12