Mutagenetix > Incidental Mutations

Incidental Mutation 'R0542:Plxna4'

49979

Institutional Source

Beutler Lab

Gene Symbol

Plxna4

Ensembl Gene

ENSMUSG00000029765

Gene Name

plexin A4

Synonyms

Plxa4

MMRRC Submission

038734-MU

Accession Numbers

Genbank: NM_175750

Is this an essential gene?

Possibly essential (E-score: 0.592) question?

Stock #

R0542 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32144268-32588192 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 32192297 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 1322 (R1322W)

Ref Sequence

ENSEMBL: ENSMUSP00000110748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115096]

Predicted Effect

probably damaging
Transcript: ENSMUST00000115096
AA Change: R1322W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: R1322W

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	50	490	2.3e-131	SMART
PSI	508	558	2.21e-14	SMART
PSI	654	701	2.44e-7	SMART
PSI	802	855	1.2e-6	SMART
IPT	856	950	7.25e-16	SMART
IPT	952	1036	4.1e-15	SMART
IPT	1038	1138	2.86e-14	SMART
IPT	1140	1229	6.88e-1	SMART
transmembrane domain	1237	1259	N/A	INTRINSIC
Pfam:Plexin_cytopl	1310	1863	1.8e-264	PFAM

Meta Mutation Damage Score

0.4965

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

99% (70/71)

MGI Phenotype

PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	A	G	2: 148,782,172	N22S	probably benign	Het
Abhd12b	C	A	12: 70,163,495	N71K	possibly damaging	Het
Adgrl2	A	G	3: 148,859,218	I242T	probably damaging	Het
Adgrv1	A	G	13: 81,573,318	S714P	probably damaging	Het
Agap3	G	A	5: 24,500,186	R704Q	possibly damaging	Het
Ankrd11	T	C	8: 122,895,770	R448G	probably damaging	Het
Anks1b	T	C	10: 90,073,967		probably benign	Het
Caml	A	T	13: 55,623,161	Q24L	possibly damaging	Het
Cdc14b	G	A	13: 64,243,683	T124I	probably benign	Het
Clca2	A	G	3: 145,075,810		probably benign	Het
Col12a1	A	G	9: 79,605,328		probably null	Het
Crispld1	T	C	1: 17,746,768	V183A	possibly damaging	Het
Dhx40	C	T	11: 86,804,256		probably null	Het
Dmxl1	T	A	18: 49,893,694	D1956E	probably benign	Het
Dsc2	A	G	18: 20,051,226	V35A	probably damaging	Het
Dusp27	A	T	1: 166,101,284	M253K	possibly damaging	Het
Elovl2	A	G	13: 41,191,976		probably benign	Het
Gapvd1	T	C	2: 34,725,036		probably benign	Het
Gnaq	T	A	19: 16,219,618	I56N	probably damaging	Het
Gpr139	T	C	7: 119,145,083	D93G	probably benign	Het
Hars	C	T	18: 36,771,181	R215H	probably benign	Het
Helz2	C	A	2: 181,232,089	W2204L	probably damaging	Het
Itgb6	A	T	2: 60,605,136	C757S	possibly damaging	Het
Kpnb1	G	A	11: 97,187,572	T5I	probably benign	Het
Krt82	T	C	15: 101,545,600		probably benign	Het
Lgals9	T	A	11: 78,969,720	K175N	possibly damaging	Het
Lrp2	A	G	2: 69,428,654	I4564T	probably benign	Het
Mblac1	A	G	5: 138,194,536	T47A	possibly damaging	Het
Med12l	G	A	3: 59,042,401	D182N	probably damaging	Het
Megf9	A	G	4: 70,435,348	I407T	probably benign	Het
Mtmr6	A	T	14: 60,292,129		probably null	Het
Mtor	A	G	4: 148,540,450	T2173A	probably benign	Het
Mzt1	A	T	14: 99,040,502		probably benign	Het
Narf	T	C	11: 121,252,864	L444P	probably damaging	Het
Nsd1	A	T	13: 55,260,458	Q1305L	possibly damaging	Het
Ntsr1	A	G	2: 180,542,581	Y359C	probably damaging	Het
Olfm1	A	G	2: 28,214,628	D159G	possibly damaging	Het
Olfr168	A	T	16: 19,529,982	*313R	probably null	Het
Pcdh1	C	T	18: 38,189,922	V953I	probably damaging	Het
Pcdhb11	A	T	18: 37,423,834	D739V	probably damaging	Het
Pdgfd	A	G	9: 6,359,769	N280S	probably damaging	Het
Per2	A	T	1: 91,438,332		probably null	Het
Pfkp	G	T	13: 6,621,992	C122*	probably null	Het
Ppox	A	G	1: 171,279,244	L202P	probably damaging	Het
Ppp1r3e	G	A	14: 54,877,131	P58L	probably benign	Het
Prr23a2	A	C	9: 98,857,033	N148T	probably benign	Het
Psd	T	C	19: 46,314,210	T842A	probably damaging	Het
Ranbp2	C	T	10: 58,478,414	A1652V	probably benign	Het
Rragd	G	A	4: 33,007,103	V144M	probably damaging	Het
Sema6a	T	G	18: 47,248,576	D968A	probably damaging	Het
Slc30a5	A	T	13: 100,809,285		probably null	Het
Snx17	G	T	5: 31,196,551		probably null	Het
Syt14	G	T	1: 192,930,803	T563K	probably damaging	Het
Tada3	T	C	6: 113,375,214	K85E	probably damaging	Het
Tspear	T	C	10: 77,881,087	V532A	probably benign	Het
Ttc30b	A	G	2: 75,936,711	V566A	probably damaging	Het
Ttn	A	T	2: 76,893,109	C6426S	possibly damaging	Het
Unc79	T	C	12: 103,094,178		probably benign	Het
Usp19	A	G	9: 108,494,385		probably null	Het
Vav3	G	A	3: 109,527,430	D426N	probably damaging	Het
Vezt	T	C	10: 94,007,096		probably null	Het
Vldlr	G	T	19: 27,236,255	R114L	probably benign	Het
Wdr34	A	G	2: 30,031,825	V508A	probably damaging	Het
Wwc2	C	T	8: 47,868,379	V567I	unknown	Het
Zfp423	T	C	8: 87,780,609	T911A	probably damaging	Het
Zfp719	A	G	7: 43,589,253		probably null	Het
Zkscan16	A	T	4: 58,956,597	H293L	possibly damaging	Het
Zkscan6	A	C	11: 65,828,699	N515T	possibly damaging	Het
Znfx1	A	G	2: 167,055,655	S450P	probably damaging	Het

Other mutations in Plxna4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Plxna4	APN	6	32162091	missense	probably damaging	1.00
IGL01395:Plxna4	APN	6	32239433	missense	probably damaging	0.99
IGL01506:Plxna4	APN	6	32516535	missense	probably damaging	1.00
IGL01606:Plxna4	APN	6	32158001	missense	probably damaging	1.00
IGL01753:Plxna4	APN	6	32310478	missense	probably benign	0.06
IGL01767:Plxna4	APN	6	32237678	missense	possibly damaging	0.51
IGL01968:Plxna4	APN	6	32215204	missense	possibly damaging	0.81
IGL02109:Plxna4	APN	6	32215641	missense	probably benign
IGL02299:Plxna4	APN	6	32165156	missense	probably benign	0.01
IGL02306:Plxna4	APN	6	32206124	missense	probably benign	0.19
IGL02312:Plxna4	APN	6	32165117	missense	possibly damaging	0.79
IGL02326:Plxna4	APN	6	32152905	missense	probably damaging	0.99
IGL02658:Plxna4	APN	6	32185411	missense	probably damaging	1.00
IGL02683:Plxna4	APN	6	32517606	missense	probably benign	0.03
IGL02701:Plxna4	APN	6	32517559	missense	probably benign	0.01
IGL02995:Plxna4	APN	6	32516595	missense	probably damaging	1.00
IGL03030:Plxna4	APN	6	32202225	missense	probably benign	0.01
IGL03264:Plxna4	APN	6	32178402	missense	possibly damaging	0.64
IGL03304:Plxna4	APN	6	32165051	splice site	probably benign
IGL03382:Plxna4	APN	6	32202194	missense	probably benign	0.23
inclined	UTSW	6	32237723	nonsense	probably null
Slope	UTSW	6	32234606	missense	probably benign	0.00
G4846:Plxna4	UTSW	6	32192272	missense	probably damaging	1.00
R0133:Plxna4	UTSW	6	32197074	missense	probably benign	0.00
R0200:Plxna4	UTSW	6	32197088	missense	probably damaging	0.99
R0308:Plxna4	UTSW	6	32237768	missense	probably benign	0.01
R0468:Plxna4	UTSW	6	32215246	missense	probably damaging	1.00
R0505:Plxna4	UTSW	6	32202119	missense	probably benign
R0548:Plxna4	UTSW	6	32158015	missense	probably damaging	1.00
R0652:Plxna4	UTSW	6	32185501	missense	probably damaging	1.00
R1144:Plxna4	UTSW	6	32197156	missense	possibly damaging	0.58
R1190:Plxna4	UTSW	6	32251136	missense	probably damaging	1.00
R1228:Plxna4	UTSW	6	32224152	splice site	probably null
R1569:Plxna4	UTSW	6	32185475	missense	possibly damaging	0.78
R1803:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R1832:Plxna4	UTSW	6	32197826	missense	probably benign	0.01
R2068:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R2157:Plxna4	UTSW	6	32516974	missense	probably benign	0.00
R2842:Plxna4	UTSW	6	32215631	critical splice donor site	probably null
R2849:Plxna4	UTSW	6	32185532	missense	probably damaging	1.00
R2892:Plxna4	UTSW	6	32517037	missense	probably damaging	1.00
R2930:Plxna4	UTSW	6	32165780	missense	probably damaging	1.00
R3892:Plxna4	UTSW	6	32215654	missense	probably damaging	1.00
R4065:Plxna4	UTSW	6	32236365	nonsense	probably null
R4276:Plxna4	UTSW	6	32200948	missense	probably benign	0.29
R4307:Plxna4	UTSW	6	32163509	missense	probably damaging	0.99
R4331:Plxna4	UTSW	6	32150545	nonsense	probably null
R4478:Plxna4	UTSW	6	32196133	missense	possibly damaging	0.89
R4529:Plxna4	UTSW	6	32496896	critical splice acceptor site	probably null
R4566:Plxna4	UTSW	6	32517403	missense	probably benign	0.00
R4568:Plxna4	UTSW	6	32152938	missense	probably damaging	1.00
R4664:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R4685:Plxna4	UTSW	6	32165844	missense	probably damaging	1.00
R4701:Plxna4	UTSW	6	32516688	missense	probably damaging	0.99
R4939:Plxna4	UTSW	6	32165762	missense	probably damaging	1.00
R5153:Plxna4	UTSW	6	32224159	intron	probably null
R5181:Plxna4	UTSW	6	32516997	missense	probably damaging	1.00
R5256:Plxna4	UTSW	6	32251072	missense	probably benign	0.03
R5259:Plxna4	UTSW	6	32517021	missense	possibly damaging	0.89
R5306:Plxna4	UTSW	6	32206121	missense	probably damaging	0.99
R5487:Plxna4	UTSW	6	32517283	missense	probably damaging	1.00
R5510:Plxna4	UTSW	6	32178358	missense	probably damaging	0.96
R5542:Plxna4	UTSW	6	32206230	missense	probably damaging	1.00
R5567:Plxna4	UTSW	6	32157980	missense	possibly damaging	0.61
R5634:Plxna4	UTSW	6	32237723	nonsense	probably null
R5653:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R5665:Plxna4	UTSW	6	32215722	missense	probably damaging	1.00
R5845:Plxna4	UTSW	6	32237776	missense	probably damaging	1.00
R5909:Plxna4	UTSW	6	32517246	missense	probably damaging	1.00
R5938:Plxna4	UTSW	6	32234606	missense	probably benign	0.00
R5973:Plxna4	UTSW	6	32251065	splice site	probably null
R6433:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6482:Plxna4	UTSW	6	32516737	missense	probably benign
R6560:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6721:Plxna4	UTSW	6	32200859	missense	probably benign	0.26
R6810:Plxna4	UTSW	6	32310522	missense	probably benign	0.18
R6985:Plxna4	UTSW	6	32237708	missense	probably damaging	1.00
R7024:Plxna4	UTSW	6	32192269	missense	probably damaging	1.00
R7046:Plxna4	UTSW	6	32516505	missense	probably damaging	1.00
R7137:Plxna4	UTSW	6	32517264	missense	probably damaging	1.00
R7163:Plxna4	UTSW	6	32496756	missense	probably benign	0.01
R7199:Plxna4	UTSW	6	32215178	nonsense	probably null
R7248:Plxna4	UTSW	6	32162160	missense	probably damaging	0.99
R7260:Plxna4	UTSW	6	32239520	missense	possibly damaging	0.79
R7361:Plxna4	UTSW	6	32196122	critical splice donor site	probably null
R7383:Plxna4	UTSW	6	32152799	critical splice donor site	probably null
R7405:Plxna4	UTSW	6	32196319	missense	probably benign	0.00
R7516:Plxna4	UTSW	6	32237768	missense	probably benign	0.00
R7635:Plxna4	UTSW	6	32496741	missense	probably damaging	0.98
R7754:Plxna4	UTSW	6	32152872	missense	probably damaging	1.00
R7763:Plxna4	UTSW	6	32223980	missense	probably damaging	0.99
R7789:Plxna4	UTSW	6	32206233	critical splice acceptor site	probably null
V1024:Plxna4	UTSW	6	32234574	missense	probably damaging	1.00
X0027:Plxna4	UTSW	6	32517044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCCCTAAAGTGCTACTGAAATGTG -3'
(R):5'- TCCTGTCCTTATTCTGAGGAGTAACCC -3'

Sequencing Primer
(F):5'- CCTCAGGCAAGATGTGCTATC -3'
(R):5'- tgtaccgccatgcccag -3'

Posted On

2013-06-12