Incidental Mutation 'R5747:Gm10549'
ID499931
Institutional Source Beutler Lab
Gene Symbol Gm10549
Ensembl Gene ENSMUSG00000073610
Gene Namepredicted gene 10549
Synonyms
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5747 (G1)
Quality Score75
Status Validated
Chromosome18
Chromosomal Location33464163-33472448 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 33464305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051087] [ENSMUST00000097634] [ENSMUST00000168890] [ENSMUST00000171533]
Predicted Effect probably benign
Transcript: ENSMUST00000051087
SMART Domains Protein: ENSMUSP00000058132
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000097634
AA Change: A48D
SMART Domains Protein: ENSMUSP00000095236
Gene: ENSMUSG00000073610
AA Change: A48D

DomainStartEndE-ValueType
low complexity region 56 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168890
SMART Domains Protein: ENSMUSP00000130297
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171533
SMART Domains Protein: ENSMUSP00000127787
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Gm10549
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02648:Gm10549 APN 18 33464250 unclassified probably benign
R0374:Gm10549 UTSW 18 33464182 unclassified probably benign
R0668:Gm10549 UTSW 18 33470850 missense unknown
R1806:Gm10549 UTSW 18 33470788 missense unknown
R4214:Gm10549 UTSW 18 33464477 splice site probably null
R4826:Gm10549 UTSW 18 33470785 missense unknown
R5748:Gm10549 UTSW 18 33464305 unclassified probably benign
R5766:Gm10549 UTSW 18 33464305 unclassified probably benign
R5796:Gm10549 UTSW 18 33464305 unclassified probably benign
R6101:Gm10549 UTSW 18 33464305 unclassified probably benign
R6129:Gm10549 UTSW 18 33464305 unclassified probably benign
R6130:Gm10549 UTSW 18 33464305 unclassified probably benign
R6218:Gm10549 UTSW 18 33464305 unclassified probably benign
R6219:Gm10549 UTSW 18 33464305 unclassified probably benign
R6220:Gm10549 UTSW 18 33464305 unclassified probably benign
R6283:Gm10549 UTSW 18 33464305 unclassified probably benign
R6298:Gm10549 UTSW 18 33464305 unclassified probably benign
R6299:Gm10549 UTSW 18 33464305 unclassified probably benign
R6309:Gm10549 UTSW 18 33464305 unclassified probably benign
R6321:Gm10549 UTSW 18 33464305 unclassified probably benign
R6322:Gm10549 UTSW 18 33464305 unclassified probably benign
R6327:Gm10549 UTSW 18 33464305 unclassified probably benign
R6337:Gm10549 UTSW 18 33464305 unclassified probably benign
R6405:Gm10549 UTSW 18 33464305 unclassified probably benign
R6420:Gm10549 UTSW 18 33464305 unclassified probably benign
R6492:Gm10549 UTSW 18 33464305 unclassified probably benign
R6494:Gm10549 UTSW 18 33464305 unclassified probably benign
R6505:Gm10549 UTSW 18 33464305 unclassified probably benign
R7173:Gm10549 UTSW 18 33464409 missense unknown
Predicted Primers PCR Primer
(F):5'- ATAATAAACCTGCGGCCGGG -3'
(R):5'- ACAGGGGCTGAGAACTTTG -3'

Sequencing Primer
(F):5'- CGGGGCATCTGAGGGAAC -3'
(R):5'- TAGCGTCTCCGGTTGCAC -3'
Posted On2017-11-28