Incidental Mutation 'R4335:Rnf207'
ID499936
Institutional Source Beutler Lab
Gene Symbol Rnf207
Ensembl Gene ENSMUSG00000058498
Gene Namering finger protein 207
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R4335 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152307019-152318993 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 152315605 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076183] [ENSMUST00000130008] [ENSMUST00000170820]
Predicted Effect silent
Transcript: ENSMUST00000076183
SMART Domains Protein: ENSMUSP00000075540
Gene: ENSMUSG00000058498

DomainStartEndE-ValueType
RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 3.6e-11 PFAM
Pfam:DUF3583 204 378 1.2e-10 PFAM
coiled coil region 422 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127565
Predicted Effect probably benign
Transcript: ENSMUST00000130008
SMART Domains Protein: ENSMUSP00000127196
Gene: ENSMUSG00000058498

DomainStartEndE-ValueType
RING 25 63 5.6e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146496
Predicted Effect silent
Transcript: ENSMUST00000170820
SMART Domains Protein: ENSMUSP00000129400
Gene: ENSMUSG00000058498

DomainStartEndE-ValueType
RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 1e-11 PFAM
low complexity region 236 242 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
coiled coil region 387 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Abca9 G A 11: 110,152,017 T402M probably damaging Het
Apbb1ip G A 2: 22,871,562 probably null Het
Armh1 A T 4: 117,214,463 I308N probably damaging Het
Ceacam5 G A 7: 17,752,129 R517Q probably benign Het
Clic4 C T 4: 135,218,605 S167N probably benign Het
Ehbp1l1 A T 19: 5,708,769 L1644Q probably damaging Het
Erh A G 12: 80,642,841 L3P probably benign Het
Fam71d T C 12: 78,712,232 S109P possibly damaging Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fsd2 A T 7: 81,542,065 S521R probably damaging Het
Hace1 A G 10: 45,709,961 Y865C probably damaging Het
Iqcf1 G A 9: 106,501,873 R62H possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Leng8 T C 7: 4,147,038 Y781H probably damaging Het
Med8 G T 4: 118,409,370 probably null Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Nat8f2 A G 6: 85,868,251 L43P probably damaging Het
Omd A C 13: 49,590,236 D254A probably benign Het
Psd2 G T 18: 36,007,530 A622S probably damaging Het
Rsbn1l T C 5: 20,908,193 I444V probably null Het
Rxfp1 A G 3: 79,686,798 probably null Het
Selenot C A 3: 58,585,301 R70S possibly damaging Het
Sox6 A G 7: 115,512,724 S557P probably benign Het
Sp9 G A 2: 73,274,289 V396M probably damaging Het
Ston1 T C 17: 88,635,697 F177S probably damaging Het
Syne2 A G 12: 76,028,092 E4602G probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Tsga13 T C 6: 30,900,045 D179G probably damaging Het
Wdr27 T A 17: 14,920,756 probably null Het
Other mutations in Rnf207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Rnf207 APN 4 152318261 splice site probably benign
IGL02325:Rnf207 APN 4 152311780 missense probably damaging 0.97
IGL02451:Rnf207 APN 4 152312412 missense probably benign 0.25
R0311:Rnf207 UTSW 4 152315779 missense probably damaging 1.00
R0462:Rnf207 UTSW 4 152313372 missense possibly damaging 0.78
R0671:Rnf207 UTSW 4 152307468 missense probably benign 0.00
R0845:Rnf207 UTSW 4 152312064 splice site probably benign
R1544:Rnf207 UTSW 4 152313871 splice site probably benign
R1667:Rnf207 UTSW 4 152313215 missense probably benign 0.00
R4052:Rnf207 UTSW 4 152311437 missense probably benign 0.41
R4649:Rnf207 UTSW 4 152312155 missense probably benign 0.06
R5033:Rnf207 UTSW 4 152313209 missense probably benign 0.00
R5268:Rnf207 UTSW 4 152313889 missense probably damaging 1.00
R5603:Rnf207 UTSW 4 152312394 missense probably damaging 1.00
R5938:Rnf207 UTSW 4 152317928 intron probably benign
R6147:Rnf207 UTSW 4 152315655 missense probably damaging 1.00
R6181:Rnf207 UTSW 4 152308848 missense probably benign 0.00
R6866:Rnf207 UTSW 4 152312532 missense possibly damaging 0.81
R7166:Rnf207 UTSW 4 152311780 missense probably damaging 0.98
R7177:Rnf207 UTSW 4 152312177 missense probably benign 0.43
R7354:Rnf207 UTSW 4 152314091 missense probably damaging 0.96
R7893:Rnf207 UTSW 4 152311438 missense probably damaging 0.99
R8200:Rnf207 UTSW 4 152314035 critical splice donor site probably null
X0026:Rnf207 UTSW 4 152316042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAAAGAGTGCGTGGATG -3'
(R):5'- TGTTTTCCACCGACAAGAAGTC -3'

Sequencing Primer
(F):5'- TGGATGGCTGCCTCCTC -3'
(R):5'- AAGAAGTCGCTGCTGTGCATC -3'
Posted On2017-11-30