Mutagenetix > Incidental Mutations

Incidental Mutation 'R5223:Samm50'

499940

Institutional Source

Beutler Lab

Gene Symbol

Samm50

Ensembl Gene

ENSMUSG00000022437

Gene Name

SAMM50 sorting and assembly machinery component

Synonyms

1110030L07Rik

MMRRC Submission

042796-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84192241-84217267 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 84200630 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 187 (N187K)

Ref Sequence

ENSEMBL: ENSMUSP00000023071 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023071]

Predicted Effect

probably benign
Transcript: ENSMUST00000023071
AA Change: N187K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437
AA Change: N187K

Domain	Start	End	E-Value	Type
low complexity region	24	35	N/A	INTRINSIC
Pfam:Bac_surface_Ag	151	468	1.8e-68	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229608

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229751

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230498

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230659

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230668

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230830

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231124

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Samm50

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Samm50	APN	15	84200375	missense	possibly damaging	0.82
IGL01061:Samm50	APN	15	84202254	missense	probably benign	0.00
IGL01549:Samm50	APN	15	84202781	missense	probably benign
IGL01586:Samm50	APN	15	84195838	missense	probably benign	0.03
IGL02494:Samm50	APN	15	84195814	missense	probably benign
IGL02607:Samm50	APN	15	84207838	missense	probably benign	0.09
IGL03244:Samm50	APN	15	84214140	missense	probably benign	0.09
IGL03340:Samm50	APN	15	84198663	critical splice donor site	probably null
R0591:Samm50	UTSW	15	84211168	missense	probably benign
R0634:Samm50	UTSW	15	84214171	synonymous	silent
R1780:Samm50	UTSW	15	84211127	missense	probably damaging	0.99
R2192:Samm50	UTSW	15	84200424	critical splice donor site	probably null
R2205:Samm50	UTSW	15	84202314	missense	probably benign	0.01
R3800:Samm50	UTSW	15	84192374	missense	probably damaging	0.99
R4285:Samm50	UTSW	15	84197012	missense	probably damaging	1.00
R4333:Samm50	UTSW	15	84202830	missense	probably benign	0.02
R4780:Samm50	UTSW	15	84210610	missense	possibly damaging	0.88
R5639:Samm50	UTSW	15	84214128	missense	probably benign	0.22
R6258:Samm50	UTSW	15	84200311	missense	probably damaging	1.00
R6258:Samm50	UTSW	15	84200312	missense	probably damaging	0.98
R6437:Samm50	UTSW	15	84204097	critical splice donor site	probably null
R6452:Samm50	UTSW	15	84204097	critical splice donor site	probably benign
R6715:Samm50	UTSW	15	84211058	missense	probably benign
R6957:Samm50	UTSW	15	84198649	missense	probably damaging	1.00
R7409:Samm50	UTSW	15	84197030	missense	probably benign	0.32
R7459:Samm50	UTSW	15	84195856	critical splice donor site	probably null
R7706:Samm50	UTSW	15	84200880	splice site	probably null
R7910:Samm50	UTSW	15	84214145	missense	possibly damaging	0.49
R8421:Samm50	UTSW	15	84210585	missense	probably benign	0.04
R8443:Samm50	UTSW	15	84210501	missense	possibly damaging	0.82
X0067:Samm50	UTSW	15	84202833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGGTCCTTGAGCTCATTGG -3'
(R):5'- TACCTGCATTAGCTAGCGAAG -3'

Sequencing Primer
(F):5'- AGCTCATTGGCTTGGTGTAAAC -3'
(R):5'- CCTGCATTAGCTAGCGAAGAGGAG -3'

Posted On

2017-11-30