Incidental Mutation 'R5284:Epb41l4a'
ID499948
Institutional Source Beutler Lab
Gene Symbol Epb41l4a
Ensembl Gene ENSMUSG00000024376
Gene Nameerythrocyte membrane protein band 4.1 like 4a
SynonymsNBL4, Epb4.1l4a
MMRRC Submission 042841-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5284 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location33796327-34007206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33798800 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 581 (T581S)
Ref Sequence ENSEMBL: ENSMUSP00000025234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025234]
Predicted Effect probably damaging
Transcript: ENSMUST00000025234
AA Change: T581S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025234
Gene: ENSMUSG00000024376
AA Change: T581S

DomainStartEndE-ValueType
B41 7 211 3.32e-78 SMART
FERM_C 215 303 1.48e-28 SMART
FA 310 357 2.25e-10 SMART
low complexity region 468 494 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 589 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179138
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the band 4.1 protein superfamily. Members of this superfamily are thought to play an important role in regulating interactions between the cytoskeleton and plasma membrane, and contain an amino terminal conserved domain that binds glycophorin C. This gene product is thought to be involved in the beta-catenin signaling pathway. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T A 7: 45,981,059 Q1259L probably benign Het
AI314180 C T 4: 58,836,172 E723K possibly damaging Het
Arhgef26 T C 3: 62,419,631 S522P probably damaging Het
Asic5 C T 3: 82,008,523 P218L probably damaging Het
Atad1 T C 19: 32,687,271 M248V probably benign Het
Bank1 T C 3: 136,064,154 D522G probably damaging Het
Bod1l G A 5: 41,820,467 S1168L probably benign Het
Cactin A G 10: 81,323,762 D51G probably damaging Het
Camkk1 A G 11: 73,037,555 D261G probably benign Het
Cep152 A G 2: 125,580,021 S930P probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crim1 A T 17: 78,313,266 R378S possibly damaging Het
Dcun1d4 T C 5: 73,522,682 probably null Het
Dhdds A G 4: 133,980,212 V187A probably benign Het
Egfem1 A G 3: 29,650,787 E251G possibly damaging Het
Ehhadh T C 16: 21,763,344 probably null Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Erg C T 16: 95,459,243 M1I probably null Het
Fastkd1 T C 2: 69,712,188 T92A probably benign Het
Gabpb1 T C 2: 126,652,357 H116R possibly damaging Het
Gucy2c A G 6: 136,763,043 L262P possibly damaging Het
Ifi203 C T 1: 173,928,708 probably benign Het
Kcnk13 A C 12: 100,061,289 I208L probably benign Het
Klhl7 A G 5: 24,159,617 T550A probably benign Het
Krtap12-1 G T 10: 77,720,965 C114F possibly damaging Het
Myh7b A G 2: 155,632,314 T1650A probably benign Het
Myo19 T A 11: 84,885,272 probably null Het
Nav1 C T 1: 135,449,963 W1656* probably null Het
Nup188 A T 2: 30,330,635 S907C probably damaging Het
Olfr212 T A 6: 116,516,552 Y258* probably null Het
Oplah A T 15: 76,306,559 H125Q probably benign Het
Pcnx A T 12: 81,919,029 T657S probably benign Het
Phf14 C A 6: 11,997,120 Q796K probably damaging Het
Plaa T C 4: 94,569,637 I699V probably benign Het
Prex2 C A 1: 11,266,090 S1504* probably null Het
Prpf18 G A 2: 4,645,670 Q50* probably null Het
Rnf213 A G 11: 119,458,866 Y3851C possibly damaging Het
Rpgrip1 A G 14: 52,149,276 D726G probably damaging Het
Sacm1l T C 9: 123,586,420 S487P probably damaging Het
Setdb1 G T 3: 95,327,570 R941S probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Smg8 G A 11: 87,080,311 S878L possibly damaging Het
Trpc4 T A 3: 54,279,947 V440E probably damaging Het
Tsen15 A G 1: 152,371,873 S123P probably damaging Het
Tspan12 G T 6: 21,835,467 A69D probably damaging Het
Ubiad1 G A 4: 148,436,498 T223M probably damaging Het
Ubtfl1 A T 9: 18,409,445 K90* probably null Het
Wdr19 C T 5: 65,225,409 T492I probably damaging Het
Zfp423 C T 8: 87,781,677 D659N possibly damaging Het
Other mutations in Epb41l4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Epb41l4a APN 18 33801625 missense possibly damaging 0.95
IGL02942:Epb41l4a APN 18 33874201 missense probably damaging 1.00
IGL03051:Epb41l4a APN 18 33874772 missense probably damaging 1.00
IGL03236:Epb41l4a APN 18 33810219 missense probably damaging 0.98
PIT1430001:Epb41l4a UTSW 18 33797347 missense probably damaging 1.00
R0147:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0148:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0437:Epb41l4a UTSW 18 33880273 missense probably damaging 1.00
R1511:Epb41l4a UTSW 18 33832664 missense probably benign 0.01
R1666:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1668:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1750:Epb41l4a UTSW 18 33828208 nonsense probably null
R2022:Epb41l4a UTSW 18 33921840 missense probably benign 0.00
R2047:Epb41l4a UTSW 18 33828206 missense probably benign 0.00
R2133:Epb41l4a UTSW 18 33874195 missense probably damaging 1.00
R3741:Epb41l4a UTSW 18 33828102 critical splice donor site probably null
R4393:Epb41l4a UTSW 18 33891420 splice site probably null
R4700:Epb41l4a UTSW 18 33802507 splice site probably null
R4878:Epb41l4a UTSW 18 33798572 missense probably damaging 1.00
R5226:Epb41l4a UTSW 18 33810313 missense probably damaging 1.00
R5584:Epb41l4a UTSW 18 33854271 missense probably damaging 1.00
R5945:Epb41l4a UTSW 18 33828730 missense possibly damaging 0.89
R6005:Epb41l4a UTSW 18 33828143 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6177:Epb41l4a UTSW 18 33798815 splice site probably null
R6188:Epb41l4a UTSW 18 33832665 missense probably benign
R6314:Epb41l4a UTSW 18 33874155 missense probably damaging 1.00
R6552:Epb41l4a UTSW 18 33878979 missense probably damaging 1.00
R7605:Epb41l4a UTSW 18 33797451 missense probably damaging 0.99
R7665:Epb41l4a UTSW 18 34006016 missense possibly damaging 0.92
R7727:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7729:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7802:Epb41l4a UTSW 18 33828174 missense probably benign 0.19
R7857:Epb41l4a UTSW 18 34006045 nonsense probably null
R8281:Epb41l4a UTSW 18 33878945 missense probably damaging 1.00
X0028:Epb41l4a UTSW 18 33802537 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AACTCAGGTCTTATGCGCCTC -3'
(R):5'- GCTGTGAAATTTACTGCTTTCAGAG -3'

Sequencing Primer
(F):5'- CTTATGCGCCTCTGGGG -3'
(R):5'- GCGGAGGAACATGCTTTTAATTCAG -3'
Posted On2017-11-30