Incidental Mutation 'R5216:Gramd4'
ID499952
Institutional Source Beutler Lab
Gene Symbol Gramd4
Ensembl Gene ENSMUSG00000035900
Gene NameGRAM domain containing 4
Synonyms
MMRRC Submission 042789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5216 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location86057695-86137634 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 86134785 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044332] [ENSMUST00000088931] [ENSMUST00000123349] [ENSMUST00000138134] [ENSMUST00000138134] [ENSMUST00000138134] [ENSMUST00000138134] [ENSMUST00000138134]
Predicted Effect probably benign
Transcript: ENSMUST00000044332
SMART Domains Protein: ENSMUSP00000038203
Gene: ENSMUSG00000035891

DomainStartEndE-ValueType
Blast:PH 8 126 9e-39 BLAST
Pfam:DAGK_cat 132 274 1.1e-31 PFAM
low complexity region 356 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088931
SMART Domains Protein: ENSMUSP00000086321
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 132 190 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
GRAM 500 578 8.41e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123349
SMART Domains Protein: ENSMUSP00000117468
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000138134
SMART Domains Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
GRAM 475 553 3.86e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138134
SMART Domains Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
GRAM 475 553 3.86e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138134
SMART Domains Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
GRAM 475 553 3.86e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138134
SMART Domains Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
GRAM 475 553 3.86e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138134
SMART Domains Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
GRAM 475 553 3.86e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150767
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]).[supplied by OMIM, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,061,162 V84D probably damaging Het
Abcb1b T C 5: 8,813,705 V220A probably benign Het
Actg1 A T 11: 120,347,754 M82K probably damaging Het
Ahi1 T C 10: 20,960,076 S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 G397C probably damaging Het
Arhgef3 A G 14: 27,401,842 T507A probably benign Het
Atg7 A G 6: 114,724,949 D682G probably damaging Het
Atp13a3 A G 16: 30,340,284 I783T probably damaging Het
Atp9a T C 2: 168,674,888 I362V probably benign Het
BC067074 G A 13: 113,342,413 C1497Y probably benign Het
Birc6 T A 17: 74,613,470 I168K probably damaging Het
Brca2 T A 5: 150,542,980 Y2070N probably damaging Het
Cabp7 A G 11: 4,738,873 I199T probably damaging Het
Cacng5 A G 11: 107,877,489 F231L possibly damaging Het
Cngb3 T A 4: 19,415,729 V413D possibly damaging Het
Col24a1 G A 3: 145,315,310 E481K possibly damaging Het
Ctr9 T A 7: 111,045,458 I560N possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Fat3 T C 9: 16,377,537 D230G probably damaging Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Hoxd1 A T 2: 74,764,351 N317Y probably damaging Het
Kcnc4 A G 3: 107,439,441 S623P probably benign Het
Klhl20 A G 1: 161,093,679 probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lpin2 C T 17: 71,242,760 S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Mgll T A 6: 88,766,329 C110* probably null Het
Mmp14 A G 14: 54,437,663 N251D possibly damaging Het
Olfr393 A T 11: 73,847,436 S230T probably damaging Het
Olfr552 A G 7: 102,604,821 T156A probably benign Het
Olfr857 T A 9: 19,713,289 V154E probably benign Het
Pfkl T G 10: 78,009,670 D5A probably damaging Het
Pik3c3 A G 18: 30,272,976 Y9C probably damaging Het
Pkhd1l1 T A 15: 44,495,647 Y417* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sulf1 T A 1: 12,796,874 M94K probably benign Het
Synrg A G 11: 83,982,196 T157A probably damaging Het
Syt1 T C 10: 108,642,257 N102S probably benign Het
Tnip2 C T 5: 34,503,805 R101H probably damaging Het
Trmt2a A G 16: 18,252,184 D421G probably benign Het
Vmn1r67 A G 7: 10,447,163 D57G probably benign Het
Wnt2b A G 3: 104,961,345 L43P possibly damaging Het
Zfp113 C T 5: 138,150,715 D56N probably damaging Het
Zfp184 C T 13: 21,950,236 L69F probably damaging Het
Zyx T C 6: 42,356,532 V464A probably damaging Het
Other mutations in Gramd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Gramd4 APN 15 86127018 missense probably damaging 0.97
Grasping UTSW 15 86091503 missense probably damaging 0.99
R0053:Gramd4 UTSW 15 86130138 splice site probably benign
R0622:Gramd4 UTSW 15 86091389 missense probably damaging 1.00
R1401:Gramd4 UTSW 15 86125196 missense probably damaging 1.00
R1741:Gramd4 UTSW 15 86091529 splice site probably null
R1840:Gramd4 UTSW 15 86130192 critical splice donor site probably null
R1968:Gramd4 UTSW 15 86132905 missense probably damaging 1.00
R2909:Gramd4 UTSW 15 86122183 nonsense probably null
R4345:Gramd4 UTSW 15 86134893 missense probably damaging 1.00
R4431:Gramd4 UTSW 15 86130160 missense probably damaging 1.00
R4832:Gramd4 UTSW 15 86134856 missense probably benign
R5164:Gramd4 UTSW 15 86100831 missense probably benign 0.16
R5898:Gramd4 UTSW 15 86100784 missense probably damaging 1.00
R5959:Gramd4 UTSW 15 86127557 missense probably damaging 0.99
R6303:Gramd4 UTSW 15 86134919 missense possibly damaging 0.72
R6304:Gramd4 UTSW 15 86134919 missense possibly damaging 0.72
R6678:Gramd4 UTSW 15 86091503 missense probably damaging 0.99
R6678:Gramd4 UTSW 15 86091504 missense possibly damaging 0.52
R6980:Gramd4 UTSW 15 86131969 missense probably benign 0.17
R7371:Gramd4 UTSW 15 86135406 missense probably benign 0.04
R7557:Gramd4 UTSW 15 86100900 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATCCTTAGGGACCAGCCATGC -3'
(R):5'- TGAAACCACATCCCAGGGAG -3'

Sequencing Primer
(F):5'- TGCTGACACATGCCTTACACAG -3'
(R):5'- ATCCCAGGGAGGCTCACTC -3'
Posted On2017-11-30