Incidental Mutation 'R5273:Slc22a14'
ID499956
Institutional Source Beutler Lab
Gene Symbol Slc22a14
Ensembl Gene ENSMUSG00000070280
Gene Namesolute carrier family 22 (organic cation transporter), member 14
SynonymsLOC382113
MMRRC Submission 042862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5273 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119169455-119365553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119170638 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 496 (S496P)
Ref Sequence ENSEMBL: ENSMUSP00000131982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093775] [ENSMUST00000170400]
Predicted Effect probably benign
Transcript: ENSMUST00000093775
AA Change: S496P

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000091289
Gene: ENSMUSG00000070280
AA Change: S496P

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 156 556 1.3e-28 PFAM
Pfam:MFS_1 178 514 7.8e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152061
AA Change: S70P
SMART Domains Protein: ENSMUSP00000117967
Gene: ENSMUSG00000070280
AA Change: S70P

DomainStartEndE-ValueType
transmembrane domain 73 92 N/A INTRINSIC
transmembrane domain 99 118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170400
AA Change: S496P

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280
AA Change: S496P

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 3. The encoded protein is a transmembrane protein which is thought to transport small molecules and since this protein is conserved among several species, it is suggested to have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,341 S2603P probably damaging Het
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcc4 T C 14: 118,594,821 N799S possibly damaging Het
Arhgap20 A G 9: 51,848,616 N589S probably damaging Het
Armc10 C T 5: 21,653,428 A157V possibly damaging Het
Atp2b2 A G 6: 113,759,232 L958P probably damaging Het
Bhmt2 G A 13: 93,666,578 A149V possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc7a CATCAGCTGATAT CAT 8: 129,061,609 probably null Het
Cntnap4 A G 8: 112,733,438 D141G probably damaging Het
Dis3 A G 14: 99,098,806 V88A probably benign Het
Dnajc21 A T 15: 10,454,807 C316S probably damaging Het
Dnhd1 A G 7: 105,714,482 T4084A probably damaging Het
Dock3 A C 9: 106,900,705 probably null Het
Eml5 T C 12: 98,790,688 H1894R probably damaging Het
Galc T C 12: 98,252,071 Y174C probably damaging Het
Gm4841 C T 18: 60,270,743 V93I probably benign Het
Gm7995 T C 14: 42,311,456 Y98H probably damaging Het
Gnrhr T A 5: 86,182,246 H305L possibly damaging Het
Gpr179 A T 11: 97,347,430 F323I probably damaging Het
Kdm6b G T 11: 69,404,201 P1080Q unknown Het
Man2a1 C T 17: 64,733,785 T126I probably damaging Het
Mdm4 G A 1: 132,994,582 T274M probably benign Het
Mug1 T A 6: 121,873,789 V748E probably damaging Het
Nav3 A T 10: 109,693,038 probably null Het
Olfr957 A G 9: 39,511,499 S74P possibly damaging Het
Olfr974 T C 9: 39,942,557 V99A probably benign Het
Pcdhb1 T C 18: 37,265,713 V239A probably benign Het
Ppic T A 18: 53,409,258 H126L probably damaging Het
Sdk1 T C 5: 141,998,828 F463L probably damaging Het
Shroom1 A G 11: 53,463,844 E197G possibly damaging Het
Slc27a1 G A 8: 71,584,256 G379S probably benign Het
Slco1a5 T C 6: 142,242,098 E505G probably benign Het
Snrpe A C 1: 133,609,780 probably benign Het
Sp100 G T 1: 85,709,104 V299F possibly damaging Het
Stard9 A G 2: 120,705,087 S3942G possibly damaging Het
Ttn A G 2: 76,814,604 V12969A probably damaging Het
Txndc11 T C 16: 11,128,623 Q108R probably benign Het
Wnk4 A T 11: 101,263,869 I295F probably damaging Het
Other mutations in Slc22a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Slc22a14 APN 9 119178513 missense possibly damaging 0.58
R0086:Slc22a14 UTSW 9 119222738 critical splice donor site probably benign
R0505:Slc22a14 UTSW 9 119172034 splice site probably benign
R0593:Slc22a14 UTSW 9 119169851 missense probably benign 0.15
R0597:Slc22a14 UTSW 9 119172124 missense probably damaging 0.99
R0674:Slc22a14 UTSW 9 119178542 missense probably damaging 1.00
R1290:Slc22a14 UTSW 9 119178452 missense probably damaging 1.00
R1459:Slc22a14 UTSW 9 119223761 missense possibly damaging 0.70
R1706:Slc22a14 UTSW 9 119180984 missense probably benign 0.06
R3980:Slc22a14 UTSW 9 119178486 missense probably benign 0.02
R4166:Slc22a14 UTSW 9 119178432 missense probably benign 0.00
R4166:Slc22a14 UTSW 9 119179868 missense possibly damaging 0.53
R4574:Slc22a14 UTSW 9 119179495 missense probably damaging 0.99
R4959:Slc22a14 UTSW 9 119174035 small deletion probably benign
R4973:Slc22a14 UTSW 9 119174035 small deletion probably benign
R5330:Slc22a14 UTSW 9 119230596 missense probably damaging 1.00
R5331:Slc22a14 UTSW 9 119230596 missense probably damaging 1.00
R5543:Slc22a14 UTSW 9 119173608 missense probably benign 0.01
R5801:Slc22a14 UTSW 9 119172083 missense probably benign 0.01
R6521:Slc22a14 UTSW 9 119220769 intron probably null
R6622:Slc22a14 UTSW 9 119170577 missense possibly damaging 0.81
R6948:Slc22a14 UTSW 9 119231416 missense probably damaging 1.00
R7027:Slc22a14 UTSW 9 119231215 intron probably null
R7731:Slc22a14 UTSW 9 119170611 missense possibly damaging 0.95
R7985:Slc22a14 UTSW 9 119170638 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGACTGGCTTCCCGTTTC -3'
(R):5'- GCATCCTTATGAGCATGTGC -3'

Sequencing Primer
(F):5'- CCGTTTCTGGTACCAGGGAG -3'
(R):5'- TCACAGTGCCTGCATGATTAG -3'
Posted On2017-11-30