Incidental Mutation 'R4553:Hgfac'
ID499973
Institutional Source Beutler Lab
Gene Symbol Hgfac
Ensembl Gene ENSMUSG00000029102
Gene Namehepatocyte growth factor activator
SynonymsHGFA
MMRRC Submission 041595-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4553 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location35041509-35048461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35042856 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 130 (C130S)
Ref Sequence ENSEMBL: ENSMUSP00000030985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030985] [ENSMUST00000087684] [ENSMUST00000114283] [ENSMUST00000114285] [ENSMUST00000202573]
Predicted Effect probably damaging
Transcript: ENSMUST00000030985
AA Change: C130S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030985
Gene: ENSMUSG00000029102
AA Change: C130S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
FN2 98 145 7.31e-27 SMART
EGF 160 195 2.11e-4 SMART
Pfam:fn1 199 234 7.7e-11 PFAM
EGF 241 276 1.69e-3 SMART
KR 281 366 5.2e-36 SMART
Tryp_SPc 405 639 2.07e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087684
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114283
SMART Domains Protein: ENSMUSP00000109922
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114285
SMART Domains Protein: ENSMUSP00000109924
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 707 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150139
SMART Domains Protein: ENSMUSP00000117158
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
Blast:RBD 2 33 5e-13 BLAST
Pfam:RGS12_us2 35 80 5.8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202168
Predicted Effect silent
Transcript: ENSMUST00000202573
SMART Domains Protein: ENSMUSP00000144344
Gene: ENSMUSG00000029102

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202921
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease enzyme that proteolytically activates hepatocyte growth factor (HGF) and plays a vital role in the regulation of HGF activity in the regeneration and repair of various tissues. The encoded protein is an inactive zymogen that is proteolytically activated to generate a heterodimeric enzyme consisting of a short chain and a long chain linked by a disulfide bridge. Mice lacking the encoded protein display an impairment in mucosal regeneration after injury. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display impaired intestinal regeneration and increased mortality after intestinal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,813,193 Y49C probably damaging Het
Adat1 T C 8: 111,990,280 T32A probably damaging Het
Adra2a T C 19: 54,046,735 V174A possibly damaging Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
Cand2 C A 6: 115,792,211 R661S probably damaging Het
Cd274 T C 19: 29,380,448 V180A probably benign Het
Crat T C 2: 30,408,217 T157A probably benign Het
Cts6 G A 13: 61,197,593 P230L probably damaging Het
Dppa2 A G 16: 48,310,514 Y3C possibly damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Fam71f2 A G 6: 29,287,706 I210M probably benign Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Ifi35 T C 11: 101,457,891 V188A probably damaging Het
Iqsec2 A G X: 152,211,281 H585R probably benign Het
Itih4 T C 14: 30,900,953 L842P probably damaging Het
Kif3a C A 11: 53,578,918 L119I possibly damaging Het
Lrp2 T C 2: 69,513,285 D910G probably benign Het
Lyve1 T C 7: 110,852,360 probably null Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Mx2 A G 16: 97,552,005 T398A possibly damaging Het
Nlrp4e T C 7: 23,320,979 M297T probably benign Het
Nog A G 11: 89,301,422 L200P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Phf11b G A 14: 59,341,285 P11S probably benign Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Pld1 G T 3: 28,124,702 R915L probably benign Het
Sell C T 1: 164,072,116 T34I probably benign Het
Slc34a1 G A 13: 55,412,061 probably null Het
Slc8b1 T C 5: 120,529,598 V432A probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Xab2 T C 8: 3,611,015 T700A probably benign Het
Other mutations in Hgfac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Hgfac APN 5 35046526 missense probably damaging 1.00
IGL01999:Hgfac APN 5 35044811 missense probably benign
IGL02133:Hgfac APN 5 35046587 missense probably damaging 1.00
IGL02314:Hgfac APN 5 35041597 start codon destroyed probably benign 0.21
IGL02337:Hgfac APN 5 35042378 missense probably benign 0.00
IGL02405:Hgfac APN 5 35044480 missense probably benign 0.19
IGL02451:Hgfac APN 5 35043814 splice site probably null
IGL02508:Hgfac APN 5 35047220 missense probably damaging 1.00
IGL02584:Hgfac APN 5 35043961 unclassified probably benign
IGL02986:Hgfac APN 5 35043863 missense probably benign 0.00
R0506:Hgfac UTSW 5 35044240 missense probably damaging 1.00
R0664:Hgfac UTSW 5 35048178 missense probably benign 0.34
R1733:Hgfac UTSW 5 35043674 missense probably damaging 1.00
R1775:Hgfac UTSW 5 35042850 unclassified probably benign
R1871:Hgfac UTSW 5 35042913 makesense probably null
R3826:Hgfac UTSW 5 35048162 missense probably damaging 1.00
R5888:Hgfac UTSW 5 35045407 missense probably damaging 1.00
R5905:Hgfac UTSW 5 35042362 missense probably benign 0.20
R6017:Hgfac UTSW 5 35044395 missense probably damaging 1.00
R6056:Hgfac UTSW 5 35041629 nonsense probably null
R6124:Hgfac UTSW 5 35044384 missense probably benign 0.06
R7059:Hgfac UTSW 5 35044429 missense possibly damaging 0.49
R7232:Hgfac UTSW 5 35046914 missense probably damaging 1.00
R7555:Hgfac UTSW 5 35042628 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCTACAGGAAGTGGTGAGTC -3'
(R):5'- CCTTGCCCAGGTCACTAGTATC -3'

Sequencing Primer
(F):5'- AGTGGTGAGTCCCAGAGTG -3'
(R):5'- AGGTCACTAGTATCCTCACCCTG -3'
Posted On2017-11-30