Incidental Mutation 'R4575:Ep300'
ID499986
Institutional Source Beutler Lab
Gene Symbol Ep300
Ensembl Gene ENSMUSG00000055024
Gene NameE1A binding protein p300
SynonymsKAT3B, p300
MMRRC Submission 041798-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4575 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location81585351-81652077 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 81611410 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000068387]
Predicted Effect unknown
Transcript: ENSMUST00000068387
AA Change: V391E
SMART Domains Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: V391E

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 296 309 N/A INTRINSIC
ZnF_TAZ 333 418 2.85e-32 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
Pfam:KIX 567 647 7.2e-44 PFAM
low complexity region 722 735 N/A INTRINSIC
low complexity region 831 848 N/A INTRINSIC
low complexity region 852 882 N/A INTRINSIC
low complexity region 884 920 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 1024 1039 N/A INTRINSIC
BROMO 1047 1157 6.36e-42 SMART
Blast:KAT11 1227 1300 9e-22 BLAST
KAT11 1305 1610 1.19e-140 SMART
ZnF_ZZ 1663 1704 2.67e-15 SMART
ZnF_TAZ 1728 1806 5.53e-30 SMART
low complexity region 1810 1836 N/A INTRINSIC
low complexity region 1847 1881 N/A INTRINSIC
low complexity region 1902 1927 N/A INTRINSIC
low complexity region 1962 1979 N/A INTRINSIC
Pfam:Creb_binding 1993 2099 3.5e-37 PFAM
low complexity region 2146 2158 N/A INTRINSIC
low complexity region 2187 2203 N/A INTRINSIC
low complexity region 2205 2244 N/A INTRINSIC
low complexity region 2254 2265 N/A INTRINSIC
low complexity region 2303 2346 N/A INTRINSIC
low complexity region 2390 2405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190035
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik C T 7: 131,362,596 A26T probably benign Het
4930408O17Rik C A 12: 104,871,268 noncoding transcript Het
Adgrf3 T A 5: 30,202,257 M224L probably benign Het
Ago3 T C 4: 126,346,682 H129R probably benign Het
Asb10 C T 5: 24,540,054 R99H probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Ccdc96 T C 5: 36,486,075 V475A possibly damaging Het
Clec4b2 T A 6: 123,173,680 L16Q probably damaging Het
Cyp2c68 T A 19: 39,734,361 I248L probably benign Het
Cyp2d22 G T 15: 82,371,932 A167E possibly damaging Het
Doxl2 C T 6: 48,977,568 Q547* probably null Het
Dpysl3 T C 18: 43,342,247 K382R probably damaging Het
Dscam A G 16: 96,825,623 I362T possibly damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgd4 T C 16: 16,437,032 Q507R probably damaging Het
Frem3 A G 8: 80,616,075 T1666A probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Gabrr1 C T 4: 33,158,175 T266I possibly damaging Het
Gm11563 G A 11: 99,658,449 P160S unknown Het
Gm12166 T C 11: 46,051,852 D148G probably damaging Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Haus8 A G 8: 71,263,092 V34A probably damaging Het
Hgf T C 5: 16,572,601 Y199H probably benign Het
Ide G A 19: 37,272,205 P916L unknown Het
Igsf10 G T 3: 59,330,100 H887N probably benign Het
Iigp1 A T 18: 60,390,146 H112L probably benign Het
Impg2 A G 16: 56,261,732 E1009G probably damaging Het
Khdc1a A C 1: 21,350,429 D91A probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Kprp T C 3: 92,823,964 N593S probably benign Het
Krt2 T G 15: 101,814,486 D359A probably damaging Het
Krt35 A T 11: 100,095,899 N96K probably benign Het
Lnx1 T C 5: 74,685,543 D82G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Nol6 T C 4: 41,120,299 I473V probably benign Het
Obscn T C 11: 59,122,772 D1108G probably damaging Het
Olfr553 A T 7: 102,614,769 C73* probably null Het
Olfr834 C A 9: 18,988,705 S239* probably null Het
Otop1 T C 5: 38,299,721 Y275H probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Prr14l T C 5: 32,793,644 E1935G probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rfc4 T A 16: 23,114,429 probably benign Het
Rpn2 C A 2: 157,295,324 A209E probably damaging Het
Sf1 T C 19: 6,375,913 probably benign Het
Skint5 T A 4: 113,667,193 S864C unknown Het
Slc2a10 C G 2: 165,516,321 N455K probably damaging Het
Snrnp200 T A 2: 127,235,066 I1673N probably benign Het
Sri G T 5: 8,063,693 G152W probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Uhrf1bp1 T C 17: 27,887,503 V1001A probably benign Het
Vmn2r125 T A 4: 156,349,977 D19E probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Other mutations in Ep300
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ep300 APN 15 81641418 missense unknown
IGL01128:Ep300 APN 15 81630006 unclassified probably benign
IGL01151:Ep300 APN 15 81623472 intron probably benign
IGL01414:Ep300 APN 15 81627266 unclassified probably benign
IGL01564:Ep300 APN 15 81632464 unclassified probably benign
IGL01875:Ep300 APN 15 81640023 missense unknown
IGL01945:Ep300 APN 15 81616109 unclassified probably benign
IGL02022:Ep300 APN 15 81611437 unclassified probably benign
IGL02115:Ep300 APN 15 81648818 missense unknown
IGL02129:Ep300 APN 15 81586636 missense unknown
IGL02145:Ep300 APN 15 81601166 missense unknown
IGL02149:Ep300 APN 15 81628420 unclassified probably benign
IGL02165:Ep300 APN 15 81641391 missense probably benign 0.39
IGL02226:Ep300 APN 15 81613412 missense unknown
IGL02610:Ep300 APN 15 81601522 missense unknown
IGL02731:Ep300 APN 15 81648414 missense unknown
IGL03239:Ep300 APN 15 81641388 missense unknown
R0077:Ep300 UTSW 15 81641313 missense unknown
R0145:Ep300 UTSW 15 81616127 critical splice donor site probably null
R0244:Ep300 UTSW 15 81640128 missense unknown
R0390:Ep300 UTSW 15 81640116 missense unknown
R0534:Ep300 UTSW 15 81600896 splice site probably benign
R0671:Ep300 UTSW 15 81616134 unclassified probably benign
R0840:Ep300 UTSW 15 81644933 missense unknown
R1166:Ep300 UTSW 15 81630064 unclassified probably benign
R1737:Ep300 UTSW 15 81626347 missense probably damaging 0.99
R1893:Ep300 UTSW 15 81631646 unclassified probably benign
R2136:Ep300 UTSW 15 81640447 missense unknown
R3427:Ep300 UTSW 15 81601279 missense unknown
R3757:Ep300 UTSW 15 81648589 missense unknown
R3892:Ep300 UTSW 15 81619997 unclassified probably benign
R4554:Ep300 UTSW 15 81601430 missense unknown
R4575:Ep300 UTSW 15 81649009 missense unknown
R4577:Ep300 UTSW 15 81649009 missense unknown
R4577:Ep300 UTSW 15 81611410 unclassified probably benign
R4578:Ep300 UTSW 15 81611410 unclassified probably benign
R4578:Ep300 UTSW 15 81649009 missense unknown
R5021:Ep300 UTSW 15 81640023 missense unknown
R5366:Ep300 UTSW 15 81616100 missense probably benign 0.24
R5372:Ep300 UTSW 15 81636830 missense unknown
R5393:Ep300 UTSW 15 81631618 unclassified probably benign
R5410:Ep300 UTSW 15 81648854 missense unknown
R5571:Ep300 UTSW 15 81643217 intron probably benign
R5701:Ep300 UTSW 15 81601495 missense unknown
R5772:Ep300 UTSW 15 81639914 intron probably benign
R5825:Ep300 UTSW 15 81611472 missense probably benign 0.39
R5917:Ep300 UTSW 15 81628607 unclassified probably benign
R5991:Ep300 UTSW 15 81648466 missense unknown
R6019:Ep300 UTSW 15 81641382 missense unknown
R6144:Ep300 UTSW 15 81601234 missense unknown
R6291:Ep300 UTSW 15 81648507 missense unknown
R6292:Ep300 UTSW 15 81616734 unclassified probably benign
R6599:Ep300 UTSW 15 81586713 missense unknown
R6804:Ep300 UTSW 15 81641311 nonsense probably null
R6925:Ep300 UTSW 15 81649981 missense probably benign 0.32
R7327:Ep300 UTSW 15 81627314 missense unknown
R7378:Ep300 UTSW 15 81650545 missense probably damaging 0.97
R7388:Ep300 UTSW 15 81648366 missense unknown
R7419:Ep300 UTSW 15 81648514 missense unknown
R7498:Ep300 UTSW 15 81639843 missense unknown
R7584:Ep300 UTSW 15 81628426 missense unknown
R7605:Ep300 UTSW 15 81621152 missense unknown
R7619:Ep300 UTSW 15 81608198 missense unknown
R7763:Ep300 UTSW 15 81586583 start gained probably benign
R7775:Ep300 UTSW 15 81586686 missense unknown
R7778:Ep300 UTSW 15 81586686 missense unknown
R7862:Ep300 UTSW 15 81650753 missense probably damaging 1.00
R7945:Ep300 UTSW 15 81650753 missense probably damaging 1.00
RF020:Ep300 UTSW 15 81586571 start gained probably benign
Z1177:Ep300 UTSW 15 81630097 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCCAGTTTAGCCATGTGGG -3'
(R):5'- CAGTCAAGCAGTAGTCTACACTC -3'

Sequencing Primer
(F):5'- CCATGTGGGCAATTACTCAAC -3'
(R):5'- GTAGTCTACACTCTGTCAAAGGGC -3'
Posted On2017-11-30