Mutagenetix > Incidental Mutation

Incidental Mutation 'R4577:Ep300'

499989

Institutional Source

Beutler Lab

Gene Symbol

Ep300

Ensembl Gene

ENSMUSG00000055024

Gene Name

E1A binding protein p300

Synonyms

KAT3B, p300

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4577 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81585351-81652077 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 81611410 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068387]

AlphaFold

B2RWS6

Predicted Effect

unknown
Transcript: ENSMUST00000068387
AA Change: V391E

SMART Domains

Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: V391E

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
low complexity region	162	178	N/A	INTRINSIC
low complexity region	223	242	N/A	INTRINSIC
low complexity region	296	309	N/A	INTRINSIC
ZnF_TAZ	333	418	2.85e-32	SMART
low complexity region	475	488	N/A	INTRINSIC
low complexity region	492	503	N/A	INTRINSIC
Pfam:KIX	567	647	7.2e-44	PFAM
low complexity region	722	735	N/A	INTRINSIC
low complexity region	831	848	N/A	INTRINSIC
low complexity region	852	882	N/A	INTRINSIC
low complexity region	884	920	N/A	INTRINSIC
low complexity region	924	943	N/A	INTRINSIC
low complexity region	1024	1039	N/A	INTRINSIC
BROMO	1047	1157	6.36e-42	SMART
Blast:KAT11	1227	1300	9e-22	BLAST
KAT11	1305	1610	1.19e-140	SMART
ZnF_ZZ	1663	1704	2.67e-15	SMART
ZnF_TAZ	1728	1806	5.53e-30	SMART
low complexity region	1810	1836	N/A	INTRINSIC
low complexity region	1847	1881	N/A	INTRINSIC
low complexity region	1902	1927	N/A	INTRINSIC
low complexity region	1962	1979	N/A	INTRINSIC
Pfam:Creb_binding	1993	2099	3.5e-37	PFAM
low complexity region	2146	2158	N/A	INTRINSIC
low complexity region	2187	2203	N/A	INTRINSIC
low complexity region	2205	2244	N/A	INTRINSIC
low complexity region	2254	2265	N/A	INTRINSIC
low complexity region	2303	2346	N/A	INTRINSIC
low complexity region	2390	2405	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189338

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190035

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	G	7: 139,978,130	I51T	probably damaging	Het
Abca1	C	A	4: 53,062,568	C1429F	possibly damaging	Het
Acacb	A	G	5: 114,226,831	E1524G	probably damaging	Het
Ankrd50	A	G	3: 38,455,941	V759A	probably damaging	Het
Ano9	T	C	7: 141,104,138	Q538R	probably damaging	Het
Bnip2	A	G	9: 69,997,162	D67G	probably benign	Het
Cacna1e	A	T	1: 154,402,027	S2060T	possibly damaging	Het
Cand2	G	A	6: 115,791,259	C455Y	probably damaging	Het
Cdh16	T	C	8: 104,618,559	D366G	probably damaging	Het
Cep170b	A	G	12: 112,744,718	R595G	probably damaging	Het
Chaf1a	G	A	17: 56,065,184	R784Q	probably damaging	Het
Clca4a	C	A	3: 144,954,969	S698I	probably damaging	Het
Dnah5	A	C	15: 28,289,250	Y1195S	probably benign	Het
Dysf	T	C	6: 84,137,326	I1229T	probably damaging	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
F3	A	G	3: 121,734,114	I254V	probably benign	Het
Fam166a	T	C	2: 25,220,288	S71P	probably benign	Het
Frmd4a	C	A	2: 4,603,679	A786E	possibly damaging	Het
Fsd1l	T	C	4: 53,686,397	F270S	probably damaging	Het
Galnt3	T	C	2: 66,097,859	Y231C	probably benign	Het
Gm10220	A	C	5: 26,117,871	I181S	probably benign	Het
Gm13178	A	C	4: 144,703,753	I222S	probably damaging	Het
Gnb5	G	A	9: 75,343,541	V316I	possibly damaging	Het
Gys2	A	G	6: 142,454,510	F325S	possibly damaging	Het
Hmgn2	G	A	4: 133,967,357		probably benign	Het
Hsph1	A	G	5: 149,618,843	V705A	probably benign	Het
Ighg2b	T	C	12: 113,306,892	E206G	unknown	Het
Iqub	A	T	6: 24,501,291	I220N	probably damaging	Het
Jmjd1c	A	G	10: 67,249,750	T2259A	probably damaging	Het
Kcnq3	T	C	15: 66,286,214	K4R	unknown	Het
Klk12	A	G	7: 43,773,243	D198G	probably damaging	Het
L3mbtl2	G	A	15: 81,686,285	E655K	probably benign	Het
Lrp1b	C	T	2: 40,821,719	C3163Y	probably damaging	Het
Map3k19	T	A	1: 127,822,813	R934*	probably null	Het
Map4	A	G	9: 110,081,421	T1061A	possibly damaging	Het
Mbnl1	G	A	3: 60,529,778	V50I	probably damaging	Het
Med15	G	A	16: 17,674,515	Q132*	probably null	Het
Mef2a	T	C	7: 67,240,439	N131S	probably benign	Het
Mtmr3	G	C	11: 4,497,375	L361V	probably damaging	Het
Myo5a	A	G	9: 75,217,545	E1792G	probably damaging	Het
Nup88	C	A	11: 70,969,717	A55S	probably damaging	Het
Olfr1252	T	C	2: 89,722,043	K23E	possibly damaging	Het
Olfr374	T	A	8: 72,110,323	Y252*	probably null	Het
Pacs1	G	T	19: 5,143,833	S556*	probably null	Het
Parp4	A	G	14: 56,590,410	E206G	probably benign	Het
Paxbp1	T	G	16: 91,015,154	K889N	probably damaging	Het
Pcdhga2	G	A	18: 37,669,249	A49T	possibly damaging	Het
Pcsk6	T	A	7: 65,959,266	L292*	probably null	Het
Plb1	C	T	5: 32,247,557	Q20*	probably null	Het
Plec	C	A	15: 76,184,069	Q1142H	possibly damaging	Het
Pnpla2	T	C	7: 141,457,344	S87P	probably damaging	Het
Prss28	T	C	17: 25,310,105	V140A	probably damaging	Het
Rad17	A	T	13: 100,633,278	S258T	probably damaging	Het
Rnf111	A	T	9: 70,429,584	C932*	probably null	Het
Sdc2	T	C	15: 33,017,132	Y31H	probably damaging	Het
Selenoh	T	C	2: 84,670,331	E55G	possibly damaging	Het
Serpina3k	T	G	12: 104,344,192	V327G	possibly damaging	Het
Setd1b	A	G	5: 123,148,616	E575G	unknown	Het
Slco1a4	A	T	6: 141,819,540	S325R	probably damaging	Het
Smtnl1	C	A	2: 84,818,443	V156L	possibly damaging	Het
Speg	A	G	1: 75,415,395	D1607G	probably damaging	Het
Tctex1d4	A	G	4: 117,128,615	T212A	possibly damaging	Het
Tmem101	T	A	11: 102,155,837	M69L	possibly damaging	Het
Treh	G	A	9: 44,685,911	M542I	probably benign	Het
Trim30b	T	C	7: 104,357,331	Y106C	possibly damaging	Het
Ttc6	T	C	12: 57,576,655	I280T	probably benign	Het
Ubtfl1	A	G	9: 18,409,493	T106A	probably damaging	Het
Wdr27	T	C	17: 14,903,462	H583R	probably benign	Het
Xirp2	C	T	2: 67,513,897	P2161S	probably damaging	Het

Other mutations in Ep300

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ep300	APN	15	81641418	missense	unknown
IGL01128:Ep300	APN	15	81630006	unclassified	probably benign
IGL01151:Ep300	APN	15	81623472	intron	probably benign
IGL01414:Ep300	APN	15	81627266	unclassified	probably benign
IGL01564:Ep300	APN	15	81632464	unclassified	probably benign
IGL01875:Ep300	APN	15	81640023	missense	unknown
IGL01945:Ep300	APN	15	81616109	unclassified	probably benign
IGL02022:Ep300	APN	15	81611437	unclassified	probably benign
IGL02115:Ep300	APN	15	81648818	missense	unknown
IGL02129:Ep300	APN	15	81586636	missense	unknown
IGL02145:Ep300	APN	15	81601166	missense	unknown
IGL02149:Ep300	APN	15	81628420	unclassified	probably benign
IGL02165:Ep300	APN	15	81641391	missense	probably benign	0.39
IGL02226:Ep300	APN	15	81613412	missense	unknown
IGL02610:Ep300	APN	15	81601522	missense	unknown
IGL02731:Ep300	APN	15	81648414	missense	unknown
IGL03239:Ep300	APN	15	81641388	missense	unknown
BB001:Ep300	UTSW	15	81649502	missense	unknown
BB011:Ep300	UTSW	15	81649502	missense	unknown
R0077:Ep300	UTSW	15	81641313	missense	unknown
R0145:Ep300	UTSW	15	81616127	critical splice donor site	probably null
R0244:Ep300	UTSW	15	81640128	missense	unknown
R0390:Ep300	UTSW	15	81640116	missense	unknown
R0534:Ep300	UTSW	15	81600896	splice site	probably benign
R0671:Ep300	UTSW	15	81616134	unclassified	probably benign
R0840:Ep300	UTSW	15	81644933	missense	unknown
R1166:Ep300	UTSW	15	81630064	unclassified	probably benign
R1737:Ep300	UTSW	15	81626347	missense	probably damaging	0.99
R1893:Ep300	UTSW	15	81631646	unclassified	probably benign
R2136:Ep300	UTSW	15	81640447	missense	unknown
R3427:Ep300	UTSW	15	81601279	missense	unknown
R3757:Ep300	UTSW	15	81648589	missense	unknown
R3892:Ep300	UTSW	15	81619997	unclassified	probably benign
R4554:Ep300	UTSW	15	81601430	missense	unknown
R4575:Ep300	UTSW	15	81649009	missense	unknown
R4575:Ep300	UTSW	15	81611410	unclassified	probably benign
R4577:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81611410	unclassified	probably benign
R5021:Ep300	UTSW	15	81640023	missense	unknown
R5366:Ep300	UTSW	15	81616100	missense	probably benign	0.24
R5372:Ep300	UTSW	15	81636830	missense	unknown
R5393:Ep300	UTSW	15	81631618	unclassified	probably benign
R5410:Ep300	UTSW	15	81648854	missense	unknown
R5571:Ep300	UTSW	15	81643217	intron	probably benign
R5701:Ep300	UTSW	15	81601495	missense	unknown
R5772:Ep300	UTSW	15	81639914	intron	probably benign
R5825:Ep300	UTSW	15	81611472	missense	probably benign	0.39
R5917:Ep300	UTSW	15	81628607	unclassified	probably benign
R5991:Ep300	UTSW	15	81648466	missense	unknown
R6019:Ep300	UTSW	15	81641382	missense	unknown
R6144:Ep300	UTSW	15	81601234	missense	unknown
R6291:Ep300	UTSW	15	81648507	missense	unknown
R6292:Ep300	UTSW	15	81616734	unclassified	probably benign
R6599:Ep300	UTSW	15	81586713	missense	unknown
R6804:Ep300	UTSW	15	81641311	nonsense	probably null
R6925:Ep300	UTSW	15	81649981	missense	probably benign	0.32
R7327:Ep300	UTSW	15	81627314	missense	unknown
R7378:Ep300	UTSW	15	81650545	missense	probably damaging	0.97
R7388:Ep300	UTSW	15	81648366	missense	unknown
R7419:Ep300	UTSW	15	81648514	missense	unknown
R7498:Ep300	UTSW	15	81639843	missense	unknown
R7584:Ep300	UTSW	15	81628426	missense	unknown
R7605:Ep300	UTSW	15	81621152	missense	unknown
R7619:Ep300	UTSW	15	81608198	missense	unknown
R7699:Ep300	UTSW	15	81586393	start gained	probably benign
R7763:Ep300	UTSW	15	81586583	start gained	probably benign
R7775:Ep300	UTSW	15	81586686	missense	unknown
R7778:Ep300	UTSW	15	81586686	missense	unknown
R7862:Ep300	UTSW	15	81650753	missense	probably damaging	1.00
R7924:Ep300	UTSW	15	81649502	missense	unknown
R8155:Ep300	UTSW	15	81621068	missense	unknown
R8259:Ep300	UTSW	15	81639017	missense	unknown
R8276:Ep300	UTSW	15	81650028	missense	possibly damaging	0.85
R8331:Ep300	UTSW	15	81601210	missense	unknown
R8554:Ep300	UTSW	15	81639027	missense	unknown
R9019:Ep300	UTSW	15	81648529	missense	unknown
R9128:Ep300	UTSW	15	81649745	missense	unknown
R9379:Ep300	UTSW	15	81648559	missense	unknown
R9380:Ep300	UTSW	15	81616044	missense	unknown
R9484:Ep300	UTSW	15	81636825	missense	unknown
R9659:Ep300	UTSW	15	81621072	missense	unknown
R9690:Ep300	UTSW	15	81636195	missense	unknown
R9721:Ep300	UTSW	15	81608315	missense	unknown
RF020:Ep300	UTSW	15	81586571	start gained	probably benign
Z1177:Ep300	UTSW	15	81630097	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TTCCAGTTTAGCCATGTGGG -3'
(R):5'- ACAGTCAAGCAGTAGTCTACACTC -3'

Sequencing Primer
(F):5'- CCATGTGGGCAATTACTCAAC -3'
(R):5'- GTAGTCTACACTCTGTCAAAGGGC -3'

Posted On

2017-11-30