Incidental Mutation 'R4590:Ap3d1'
ID499990
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R4590 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 80719812 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 319 (L319*)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
Predicted Effect probably null
Transcript: ENSMUST00000020420
AA Change: L319*
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: L319*

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219253
Predicted Effect probably benign
Transcript: ENSMUST00000219356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220183
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
BC003331 A G 1: 150,386,352 probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Eml5 T C 12: 98,837,341 Y1009C possibly damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Fgr T A 4: 132,995,053 V211E probably damaging Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Frmd5 C T 2: 121,765,031 probably null Het
Fut2 T C 7: 45,650,946 N134S possibly damaging Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Krt25 T C 11: 99,318,028 probably benign Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pes1 A G 11: 3,977,986 Y546C probably damaging Het
Pth1r A T 9: 110,722,271 W587R probably benign Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Rnf157 A G 11: 116,359,272 V200A probably damaging Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Sgsm2 T C 11: 74,851,132 M1011V probably damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vnn1 C A 10: 23,899,405 F184L possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 intron probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80723803 missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80730882 missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80741900 missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80721592 missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80722921 missense possibly damaging 0.92
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TACTGAAGCTTCACAGGCCC -3'
(R):5'- CTGGAGCTGGGTTTACAGTC -3'

Sequencing Primer
(F):5'- CCCCATCCTGGCCACAG -3'
(R):5'- GTTCTTCCAGTCTCCAGAGGG -3'
Posted On2017-11-30