Incidental Mutation 'R4561:Spag7'
ID 499996
Institutional Source Beutler Lab
Gene Symbol Spag7
Ensembl Gene ENSMUSG00000018287
Gene Name sperm associated antigen 7
Synonyms FSA-1, Fsa1l
MMRRC Submission 041786-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4561 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 70554597-70560242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70555816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 80 (I80M)
Ref Sequence ENSEMBL: ENSMUSP00000018431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018431] [ENSMUST00000036299] [ENSMUST00000072841] [ENSMUST00000100933] [ENSMUST00000108544] [ENSMUST00000108545] [ENSMUST00000129434] [ENSMUST00000157027] [ENSMUST00000170716] [ENSMUST00000120261] [ENSMUST00000119120] [ENSMUST00000108548] [ENSMUST00000145823]
AlphaFold Q7TNE3
Predicted Effect probably damaging
Transcript: ENSMUST00000018431
AA Change: I80M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018431
Gene: ENSMUSG00000018287
AA Change: I80M

DomainStartEndE-ValueType
R3H 31 109 3.85e-21 SMART
low complexity region 130 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036299
SMART Domains Protein: ENSMUSP00000043792
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 155 1.07e-83 SMART
low complexity region 232 243 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 370 380 N/A INTRINSIC
low complexity region 417 435 N/A INTRINSIC
low complexity region 461 485 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Pfam:TIG 541 621 6.2e-13 PFAM
low complexity region 660 679 N/A INTRINSIC
Blast:ANK 717 750 7e-12 BLAST
SCOP:d1myo__ 718 816 2e-15 SMART
Blast:ANK 762 792 4e-11 BLAST
low complexity region 829 839 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
IQ 1053 1075 2.59e2 SMART
IQ 1076 1092 2.38e2 SMART
IQ 1106 1128 5.42e0 SMART
low complexity region 1140 1157 N/A INTRINSIC
low complexity region 1180 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072841
SMART Domains Protein: ENSMUSP00000072620
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100933
SMART Domains Protein: ENSMUSP00000098493
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 36 152 8.08e-88 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
low complexity region 458 482 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:TIG 538 618 1.2e-8 PFAM
low complexity region 657 676 N/A INTRINSIC
Blast:ANK 714 747 8e-12 BLAST
SCOP:d1myo__ 715 813 2e-15 SMART
Blast:ANK 759 789 4e-11 BLAST
low complexity region 826 836 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 858 879 N/A INTRINSIC
IQ 1050 1072 2.59e2 SMART
IQ 1073 1095 1.18e1 SMART
IQ 1096 1118 5.42e0 SMART
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1170 1180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108544
SMART Domains Protein: ENSMUSP00000104184
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.2e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 4e-11 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1087 2.38e2 SMART
IQ 1101 1123 5.42e0 SMART
low complexity region 1135 1152 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108545
SMART Domains Protein: ENSMUSP00000104185
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1.1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 5e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1069 1.18e1 SMART
IQ 1070 1092 5.42e0 SMART
low complexity region 1104 1121 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129434
AA Change: I70M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115098
Gene: ENSMUSG00000018287
AA Change: I70M

DomainStartEndE-ValueType
R3H 22 99 3.06e-15 SMART
low complexity region 120 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137691
Predicted Effect probably benign
Transcript: ENSMUST00000157027
SMART Domains Protein: ENSMUSP00000115726
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Pfam:Enolase_C 142 196 1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179055
Predicted Effect probably benign
Transcript: ENSMUST00000170716
SMART Domains Protein: ENSMUSP00000128714
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120261
SMART Domains Protein: ENSMUSP00000113667
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 7e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1063 2.38e2 SMART
IQ 1077 1099 5.42e0 SMART
low complexity region 1111 1128 N/A INTRINSIC
low complexity region 1151 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119120
SMART Domains Protein: ENSMUSP00000113847
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.1e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 8e-13 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1093 1.18e1 SMART
IQ 1094 1116 5.42e0 SMART
low complexity region 1128 1145 N/A INTRINSIC
low complexity region 1168 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108548
SMART Domains Protein: ENSMUSP00000104188
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179738
Predicted Effect probably benign
Transcript: ENSMUST00000145823
SMART Domains Protein: ENSMUSP00000123602
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 137 2.55e-44 SMART
low complexity region 146 165 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 69,837,848 (GRCm39) S1601P probably damaging Het
Arnt A G 3: 95,359,924 (GRCm39) N56D probably damaging Het
Atad5 A G 11: 79,986,715 (GRCm39) T601A probably benign Het
Calr4 A G 4: 109,103,379 (GRCm39) N163S probably damaging Het
Cenpc1 C A 5: 86,195,491 (GRCm39) A93S probably damaging Het
Cep135 C T 5: 76,786,040 (GRCm39) H1048Y possibly damaging Het
Ctnna2 A G 6: 77,613,696 (GRCm39) probably null Het
Ddx60 T C 8: 62,395,495 (GRCm39) L144P probably damaging Het
Dera A T 6: 137,757,736 (GRCm39) T96S possibly damaging Het
Dock9 T A 14: 121,796,419 (GRCm39) M1853L probably benign Het
Erbb4 G A 1: 68,383,080 (GRCm39) R306* probably null Het
Glyat G T 19: 12,628,644 (GRCm39) L146F possibly damaging Het
Grk4 C A 5: 34,852,157 (GRCm39) Q134K probably benign Het
Hkdc1 T C 10: 62,245,618 (GRCm39) Q181R probably benign Het
Huwe1 A T X: 150,646,955 (GRCm39) I682F probably damaging Het
Ipo4 C T 14: 55,867,546 (GRCm39) probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,479,262 (GRCm39) probably benign Het
Kcnd2 A G 6: 21,216,395 (GRCm39) Q33R probably benign Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Klhl30 A T 1: 91,288,753 (GRCm39) H504L probably damaging Het
Map4 A G 9: 109,881,439 (GRCm39) Y101C possibly damaging Het
Mfn2 C A 4: 147,961,492 (GRCm39) R707L probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myof T C 19: 37,911,438 (GRCm39) N1511D probably benign Het
Neb A T 2: 52,176,167 (GRCm39) Y1431N probably damaging Het
Nlrc5 A G 8: 95,203,774 (GRCm39) T625A probably damaging Het
Or5g27 G T 2: 85,409,964 (GRCm39) C127F probably damaging Het
Pax2 A G 19: 44,824,402 (GRCm39) Y374C unknown Het
Pde8a T A 7: 80,958,568 (GRCm39) Y315* probably null Het
Pkhd1 A T 1: 20,604,943 (GRCm39) L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,681 (GRCm39) F189L probably damaging Het
Prex2 G A 1: 11,254,769 (GRCm39) probably null Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Slc22a22 T A 15: 57,126,781 (GRCm39) Q77L probably damaging Het
Slc24a2 A T 4: 87,145,634 (GRCm39) V140D probably damaging Het
Slc35g2 C A 9: 100,435,287 (GRCm39) R128L probably damaging Het
Slco1b2 A G 6: 141,616,893 (GRCm39) T409A probably benign Het
Srgap3 A G 6: 112,758,015 (GRCm39) M164T probably damaging Het
Sspo A T 6: 48,452,468 (GRCm39) probably null Het
Tcte2 T C 17: 13,942,864 (GRCm39) probably benign Het
Tmem117 A T 15: 94,992,677 (GRCm39) M446L probably benign Het
Tmtc4 T C 14: 123,200,710 (GRCm39) T194A probably benign Het
Ttc21b T C 2: 66,016,562 (GRCm39) Y1269C probably damaging Het
Zfp236 A T 18: 82,638,531 (GRCm39) I1363N probably damaging Het
Zfp760 T A 17: 21,942,648 (GRCm39) S608T probably benign Het
Zfp947 G T 17: 22,365,124 (GRCm39) Y183* probably null Het
Other mutations in Spag7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01764:Spag7 APN 11 70,554,933 (GRCm39) unclassified probably benign
life_savers UTSW 11 70,555,688 (GRCm39) missense probably damaging 1.00
R0371:Spag7 UTSW 11 70,555,622 (GRCm39) missense probably damaging 1.00
R0376:Spag7 UTSW 11 70,560,016 (GRCm39) unclassified probably benign
R0973:Spag7 UTSW 11 70,560,008 (GRCm39) unclassified probably benign
R1622:Spag7 UTSW 11 70,555,688 (GRCm39) missense probably damaging 1.00
R1955:Spag7 UTSW 11 70,555,844 (GRCm39) missense probably benign 0.00
R4025:Spag7 UTSW 11 70,555,300 (GRCm39) missense probably damaging 1.00
R4385:Spag7 UTSW 11 70,560,029 (GRCm39) missense probably damaging 1.00
R4409:Spag7 UTSW 11 70,555,688 (GRCm39) missense probably damaging 1.00
R4410:Spag7 UTSW 11 70,555,688 (GRCm39) missense probably damaging 1.00
R5493:Spag7 UTSW 11 70,560,059 (GRCm39) missense probably null 1.00
R6366:Spag7 UTSW 11 70,555,418 (GRCm39) missense possibly damaging 0.71
R7283:Spag7 UTSW 11 70,556,139 (GRCm39) missense probably benign 0.00
R7653:Spag7 UTSW 11 70,555,691 (GRCm39) missense probably damaging 1.00
R8404:Spag7 UTSW 11 70,560,059 (GRCm39) missense probably benign 0.15
R8502:Spag7 UTSW 11 70,560,059 (GRCm39) missense probably benign 0.15
R9628:Spag7 UTSW 11 70,555,186 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCGACAGTCATCATCTTCTCC -3'
(R):5'- AGATGGTGGAACTAAAAGCCCC -3'

Sequencing Primer
(F):5'- GACAGTCATCATCTTCTCCAAAGG -3'
(R):5'- TGGAACTAAAAGCCCCTCGCC -3'
Posted On 2017-11-30