Incidental Mutation 'R4561:Ipo4'
ID499997
Institutional Source Beutler Lab
Gene Symbol Ipo4
Ensembl Gene ENSMUSG00000002319
Gene Nameimportin 4
Synonyms
MMRRC Submission 041786-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55625400-55635957 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 55630089 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000002395] [ENSMUST00000047131] [ENSMUST00000125133] [ENSMUST00000135221] [ENSMUST00000141499] [ENSMUST00000148351]
Predicted Effect probably benign
Transcript: ENSMUST00000002395
SMART Domains Protein: ENSMUSP00000002395
Gene: ENSMUSG00000002324

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 117 2.2e-26 PFAM
low complexity region 235 249 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
Pfam:Rad21_Rec8 536 590 9.2e-23 PFAM
Predicted Effect silent
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127773
Predicted Effect silent
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146528
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155464
Predicted Effect probably benign
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228754
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Ipo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0268:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0277:Ipo4 UTSW 14 55632115 missense probably benign 0.03
R0344:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0467:Ipo4 UTSW 14 55635526 start codon destroyed probably null
R1167:Ipo4 UTSW 14 55635020 missense probably damaging 1.00
R1217:Ipo4 UTSW 14 55634359 missense probably damaging 0.98
R1804:Ipo4 UTSW 14 55629456 missense probably damaging 1.00
R2270:Ipo4 UTSW 14 55634100 missense probably damaging 1.00
R3551:Ipo4 UTSW 14 55633103 missense probably benign 0.10
R4801:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R4802:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R4804:Ipo4 UTSW 14 55630856 missense possibly damaging 0.80
R5384:Ipo4 UTSW 14 55626196 missense probably benign 0.28
R5493:Ipo4 UTSW 14 55630870 missense probably benign 0.00
R5527:Ipo4 UTSW 14 55632050 unclassified probably null
R5631:Ipo4 UTSW 14 55632069 missense probably damaging 1.00
R5631:Ipo4 UTSW 14 55633381 missense probably benign 0.08
R5788:Ipo4 UTSW 14 55628820 missense probably benign 0.02
R5929:Ipo4 UTSW 14 55631189 missense probably benign 0.03
R6018:Ipo4 UTSW 14 55626152 critical splice donor site probably null
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6707:Ipo4 UTSW 14 55628904 missense possibly damaging 0.82
R7344:Ipo4 UTSW 14 55635531 missense probably benign 0.00
R7345:Ipo4 UTSW 14 55635531 missense probably benign 0.00
R7702:Ipo4 UTSW 14 55632330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGGCTAGATAAAGCAAGC -3'
(R):5'- CTGCCGCCTACTCACTAGATTG -3'

Sequencing Primer
(F):5'- CAAGCAGATCGGGGACTTTGC -3'
(R):5'- GCCTACTCACTAGATTGACAGTC -3'
Posted On2017-11-30