Incidental Mutation 'R4578:Ercc5'
ID499999
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 5
SynonymsXpg
MMRRC Submission 041800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4578 (G1)
Quality Score215
Status Not validated
Chromosome1
Chromosomal Location44147744-44181260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44148148 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 29 (V29E)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214] [ENSMUST00000035991] [ENSMUST00000114709]
Predicted Effect probably benign
Transcript: ENSMUST00000027214
AA Change: V29E

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: V29E

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035991
SMART Domains Protein: ENSMUSP00000041964
Gene: ENSMUSG00000041684

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114709
SMART Domains Protein: ENSMUSP00000110357
Gene: ENSMUSG00000041684

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188376
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,671 Y440* probably null Het
Aldh3b3 A T 19: 3,964,832 T110S probably benign Het
Atp2b2 T C 6: 113,760,711 T901A probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Bfar A T 16: 13,687,443 I106F probably benign Het
Btbd10 T G 7: 113,322,752 I301L possibly damaging Het
Card14 G A 11: 119,326,741 R400H probably benign Het
Ccdc80 A G 16: 45,095,486 R202G probably damaging Het
Cmtm7 A C 9: 114,763,283 I82S probably benign Het
Cngb3 T A 4: 19,425,613 W474R probably damaging Het
Coq9 T C 8: 94,853,606 V285A probably benign Het
Cp A G 3: 19,973,888 E486G probably damaging Het
Crybg3 C T 16: 59,530,201 C892Y probably damaging Het
Cttn A T 7: 144,454,716 F176L probably damaging Het
Cytip T A 2: 58,160,012 N15I possibly damaging Het
Dgkb A G 12: 38,427,493 E634G possibly damaging Het
Duox1 A G 2: 122,333,777 E906G probably benign Het
Efcab6 A T 15: 83,933,168 S735T probably benign Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T A 15: 81,611,410 probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Ftcd A C 10: 76,589,258 E524D probably benign Het
Gfod2 T C 8: 105,728,246 M1V probably null Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gsta4 A T 9: 78,206,020 R127S probably benign Het
Hcn2 G A 10: 79,724,448 probably null Het
Hectd1 A G 12: 51,751,932 V2135A probably damaging Het
Hoxc6 A G 15: 103,009,661 D19G probably benign Het
Hydin A T 8: 110,267,339 T2S unknown Het
Ifna14 A T 4: 88,571,510 S97T possibly damaging Het
Igkv17-127 T C 6: 67,861,199 L14P unknown Het
Il17rb A G 14: 30,002,399 V166A probably damaging Het
Iqca T A 1: 90,073,750 I520F probably damaging Het
Kcnv2 G T 19: 27,323,594 V282L probably benign Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Lrfn5 A G 12: 61,843,977 D684G probably benign Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mis18bp1 T C 12: 65,153,881 Y124C probably damaging Het
Myh2 T A 11: 67,173,258 V48D possibly damaging Het
Nat10 A G 2: 103,754,072 M120T probably damaging Het
Nf1 T C 11: 79,445,759 S1065P probably damaging Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Pced1a A C 2: 130,422,676 L78R probably damaging Het
Peli3 T C 19: 4,934,458 D192G probably benign Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Pomgnt2 G A 9: 121,983,065 R217C probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rngtt A G 4: 33,339,050 E285G probably benign Het
Sclt1 G A 3: 41,671,465 Q356* probably null Het
Scn2b T C 9: 45,126,162 F169S possibly damaging Het
Sfta2 C T 17: 35,649,883 probably benign Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Sspo A C 6: 48,463,373 D1541A possibly damaging Het
Strc G A 2: 121,378,003 L296F possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Taf6l C A 19: 8,783,971 R10L possibly damaging Het
Tbx3 G T 5: 119,682,776 R617L probably damaging Het
Tnrc6a A G 7: 123,184,221 R1471G possibly damaging Het
Togaram1 T C 12: 65,020,326 L1714P probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Vcp A T 4: 42,984,565 M442K probably benign Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Vmn2r52 A T 7: 10,170,690 H407Q probably damaging Het
Vps13a A T 19: 16,682,110 D1684E probably damaging Het
Wdr49 T C 3: 75,335,243 M380V probably benign Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44161808 critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44161809 critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44178203 missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44180908 missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44180860 missense probably benign 0.39
R7486:Ercc5 UTSW 1 44148064 start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44175851 missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
R7994:Ercc5 UTSW 1 44178334 missense possibly damaging 0.94
R8432:Ercc5 UTSW 1 44167681 nonsense probably null
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAATTCCGCTGTTCTTTCGGGAG -3'
(R):5'- AGCCACTCTGCTGTGAGAAC -3'

Sequencing Primer
(F):5'- CCTTCAAGCCCTGGTGAC -3'
(R):5'- GCCACTCTGCTGTGAGAACTAAAG -3'
Posted On2017-11-30