Incidental Mutation 'R4581:Slc9a3'
ID500009
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms9030624O13Rik, NHE-3, NHE3
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4581 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location74121457-74169442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74164165 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 627 (Y627C)
Ref Sequence ENSEMBL: ENSMUSP00000152682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
Predicted Effect probably damaging
Transcript: ENSMUST00000036208
AA Change: Y627C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: Y627C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221703
AA Change: Y627C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225423
AA Change: Y627C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74121536 missense unknown
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74161770 missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74166056 splice site probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74161732 missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R5919:Slc9a3 UTSW 13 74158740 missense probably damaging 0.98
R6060:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R6562:Slc9a3 UTSW 13 74155161 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74150678 missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R7565:Slc9a3 UTSW 13 74157694 missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74160276 missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74157644 missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74166027 missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74155122 missense probably damaging 1.00
R8159:Slc9a3 UTSW 13 74164288 missense probably benign 0.01
R8837:Slc9a3 UTSW 13 74157704 missense probably damaging 1.00
R8939:Slc9a3 UTSW 13 74163776 missense possibly damaging 0.93
Z1176:Slc9a3 UTSW 13 74165856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTTCTTCTCAGACAAGGG -3'
(R):5'- AAGTCTGTTCACCTGGCAG -3'

Sequencing Primer
(F):5'- ACAAGGGGTCCACAGGG -3'
(R):5'- AGAGAGTCCCCTGACCCTTC -3'
Posted On2017-11-30