Incidental Mutation 'R4684:Myh4'
ID 500023
Institutional Source Beutler Lab
Gene Symbol Myh4
Ensembl Gene ENSMUSG00000057003
Gene Name myosin, heavy polypeptide 4, skeletal muscle
Synonyms MYH-2B, MM, MHC2B, MyHC-IIb, Myhsf, Minimsc, Minmus
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.386) question?
Stock # R4684 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 67128855-67151272 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 67136637 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Histidine at position 472 (D472H)
Ref Sequence ENSEMBL: ENSMUSP00000127514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018632] [ENSMUST00000170942]
AlphaFold Q5SX39
Predicted Effect probably damaging
Transcript: ENSMUST00000018632
AA Change: D472H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018632
Gene: ENSMUSG00000057003
AA Change: D472H

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 4.7e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
Pfam:Myosin_tail_1 847 1928 2.5e-168 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170942
AA Change: D472H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127514
Gene: ENSMUSG00000057003
AA Change: D472H

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-15 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
low complexity region 928 942 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit decreased growth and muscle defects including reduced muscle mass, muscle fiber loss, compensatory fiber hypertrophy, and impaired strength. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 47,083,872 (GRCm39) V45A probably benign Het
4921509C19Rik A G 2: 151,313,791 (GRCm39) I629T unknown Het
4933402N03Rik T C 7: 130,740,413 (GRCm39) R268G probably damaging Het
Abca13 A T 11: 9,384,193 (GRCm39) R3882* probably null Het
Adamts3 T G 5: 89,850,866 (GRCm39) T558P probably damaging Het
Ano2 A G 6: 125,767,304 (GRCm39) N214S probably benign Het
Arhgef4 A T 1: 34,850,866 (GRCm39) probably null Het
Boc C T 16: 44,320,743 (GRCm39) A306T probably benign Het
Capn10 T C 1: 92,871,503 (GRCm39) F367S probably damaging Het
Ccdc6 T C 10: 70,025,086 (GRCm39) probably benign Het
Cobll1 G T 2: 64,929,372 (GRCm39) S688R possibly damaging Het
Cpxm2 G T 7: 131,650,767 (GRCm39) P631Q possibly damaging Het
Cyp2c68 A G 19: 39,687,779 (GRCm39) V406A possibly damaging Het
Cyp4a30b T A 4: 115,312,200 (GRCm39) Y118N probably damaging Het
Dgki A T 6: 37,276,781 (GRCm39) probably benign Het
Disp2 A G 2: 118,623,237 (GRCm39) N1323S probably damaging Het
Dock1 T A 7: 134,326,138 (GRCm39) Y42* probably null Het
Eps8l1 C A 7: 4,476,944 (GRCm39) P471Q probably damaging Het
Fam20a A C 11: 109,612,513 (GRCm39) L10R unknown Het
Fpr-rs4 T A 17: 18,242,446 (GRCm39) I151K probably damaging Het
Gga1 C A 15: 78,769,509 (GRCm39) P161T probably damaging Het
Gm9923 T A 10: 72,145,306 (GRCm39) Y52* probably null Het
Gucy2g A G 19: 55,194,688 (GRCm39) F910L probably damaging Het
H2-T5 A T 17: 36,476,750 (GRCm39) H241Q possibly damaging Het
Helz T C 11: 107,539,971 (GRCm39) V315A probably damaging Het
Hk2 T C 6: 82,716,629 (GRCm39) Y301C probably damaging Het
Htt C T 5: 35,010,109 (GRCm39) P1521S probably damaging Het
Iah1 T C 12: 21,366,434 (GRCm39) M1T probably null Het
Ik T C 18: 36,885,467 (GRCm39) S287P probably damaging Het
Itga1 T A 13: 115,185,906 (GRCm39) D32V probably damaging Het
Itpr2 A G 6: 146,274,671 (GRCm39) F837S probably damaging Het
Klk14 A G 7: 43,341,392 (GRCm39) I15V probably benign Het
Kng2 T C 16: 22,806,391 (GRCm39) I603V possibly damaging Het
Lama1 T C 17: 68,080,773 (GRCm39) I1267T possibly damaging Het
Lrp1b A C 2: 40,812,316 (GRCm39) L2430V probably benign Het
Lrrn3 T G 12: 41,504,243 (GRCm39) K25Q possibly damaging Het
Lta4h T A 10: 93,304,678 (GRCm39) N233K probably benign Het
Mapk13 T C 17: 28,989,023 (GRCm39) I53T probably damaging Het
Mdn1 T C 4: 32,666,430 (GRCm39) F123L probably damaging Het
Nipa2 A T 7: 55,585,574 (GRCm39) N121K probably benign Het
Nostrin C T 2: 69,014,268 (GRCm39) T408M probably benign Het
Oosp2 C T 19: 11,627,017 (GRCm39) R102H probably damaging Het
Or1j18 A G 2: 36,624,686 (GRCm39) M118V probably damaging Het
Or4k15b T C 14: 50,272,287 (GRCm39) D191G probably damaging Het
Osgin2 T A 4: 16,001,946 (GRCm39) I202L probably benign Het
Pbld2 C A 10: 62,893,476 (GRCm39) R271S probably damaging Het
Pex6 C T 17: 47,023,027 (GRCm39) T201I probably benign Het
Pilra T C 5: 137,833,777 (GRCm39) I96M probably damaging Het
Pllp T A 8: 95,403,906 (GRCm39) D47V possibly damaging Het
Plxna2 A G 1: 194,444,902 (GRCm39) S765G probably benign Het
Prkca A T 11: 107,852,434 (GRCm39) Y100N probably damaging Het
Prkg1 T A 19: 31,641,579 (GRCm39) K35* probably null Het
Psmc2 A G 5: 22,008,263 (GRCm39) D389G possibly damaging Het
Rnf213 A G 11: 119,331,951 (GRCm39) T2387A probably damaging Het
Ros1 T C 10: 52,005,192 (GRCm39) N914S probably damaging Het
Ruvbl1 C A 6: 88,468,581 (GRCm39) T367K probably benign Het
Scube2 C T 7: 109,409,920 (GRCm39) R525H probably damaging Het
Sec14l4 T C 11: 3,985,200 (GRCm39) probably null Het
Secisbp2l T C 2: 125,587,862 (GRCm39) D751G probably damaging Het
Setd3 T C 12: 108,074,949 (GRCm39) D402G probably benign Het
Slc15a2 T A 16: 36,578,211 (GRCm39) K359N probably damaging Het
Slc25a21 A G 12: 57,243,721 (GRCm39) S2P probably benign Het
Slfn8 A T 11: 82,908,332 (GRCm39) H70Q probably benign Het
Spef2 T C 15: 9,647,576 (GRCm39) I944V probably benign Het
Spg11 A G 2: 121,895,557 (GRCm39) F1887S probably damaging Het
Sptbn4 A T 7: 27,066,160 (GRCm39) D649E possibly damaging Het
Sptbn4 T C 7: 27,063,844 (GRCm39) E879G probably damaging Het
Stx5a C A 19: 8,720,725 (GRCm39) R121S probably damaging Het
Tbcd T C 11: 121,384,597 (GRCm39) L26P probably damaging Het
Tecpr1 T C 5: 144,144,255 (GRCm39) D649G probably benign Het
Tfam A G 10: 71,073,677 (GRCm39) S32P probably benign Het
Tmt1b G T 10: 128,796,571 (GRCm39) C79* probably null Het
Trmt44 C T 5: 35,715,387 (GRCm39) R642H probably benign Het
Trpm3 G A 19: 22,965,145 (GRCm39) A1547T probably benign Het
Ttll6 T C 11: 96,044,003 (GRCm39) V519A probably benign Het
Umodl1 T C 17: 31,217,088 (GRCm39) F1107L probably benign Het
Usp5 A T 6: 124,794,919 (GRCm39) V677E probably damaging Het
Utp20 A T 10: 88,643,307 (GRCm39) L605* probably null Het
Utrn T C 10: 12,620,984 (GRCm39) D229G probably damaging Het
Uty A T Y: 1,176,502 (GRCm39) L178* probably null Het
Vmn2r88 A T 14: 51,650,791 (GRCm39) D168V possibly damaging Het
Vps13b T C 15: 35,646,324 (GRCm39) V1476A probably damaging Het
Vps13b C A 15: 35,879,967 (GRCm39) T3014K probably benign Het
Vps13b C T 15: 35,841,487 (GRCm39) H2506Y probably benign Het
Vps37c T C 19: 10,690,132 (GRCm39) V198A probably benign Het
Zfc3h1 T C 10: 115,259,290 (GRCm39) Y1621H probably benign Het
Zfp251 T C 15: 76,738,607 (GRCm39) D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 (GRCm39) T1994A probably benign Het
Zfp791 A G 8: 85,837,559 (GRCm39) Y102H probably benign Het
Other mutations in Myh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Myh4 APN 11 67,146,205 (GRCm39) missense probably damaging 1.00
IGL01600:Myh4 APN 11 67,151,015 (GRCm39) missense possibly damaging 0.85
IGL01737:Myh4 APN 11 67,134,245 (GRCm39) splice site probably benign
IGL02208:Myh4 APN 11 67,142,760 (GRCm39) missense possibly damaging 0.96
IGL02334:Myh4 APN 11 67,136,373 (GRCm39) missense probably damaging 1.00
IGL02376:Myh4 APN 11 67,136,554 (GRCm39) missense probably benign 0.00
IGL02429:Myh4 APN 11 67,149,808 (GRCm39) nonsense probably null
IGL02450:Myh4 APN 11 67,142,635 (GRCm39) missense probably damaging 1.00
IGL02524:Myh4 APN 11 67,140,066 (GRCm39) missense possibly damaging 0.79
IGL02612:Myh4 APN 11 67,147,305 (GRCm39) missense probably benign
IGL03024:Myh4 APN 11 67,139,305 (GRCm39) missense probably damaging 1.00
IGL03065:Myh4 APN 11 67,149,982 (GRCm39) missense probably benign 0.12
IGL03084:Myh4 APN 11 67,142,777 (GRCm39) splice site probably null
IGL03188:Myh4 APN 11 67,137,369 (GRCm39) critical splice donor site probably null
IGL03204:Myh4 APN 11 67,141,122 (GRCm39) missense possibly damaging 0.63
IGL03252:Myh4 APN 11 67,143,042 (GRCm39) missense probably damaging 0.99
IGL03345:Myh4 APN 11 67,146,304 (GRCm39) missense probably damaging 1.00
Mr_chicken UTSW 11 67,140,711 (GRCm39) missense possibly damaging 0.74
Mrs_muir UTSW 11 67,136,339 (GRCm39) missense probably damaging 1.00
Willies UTSW 11 67,132,335 (GRCm39) missense probably damaging 1.00
F6893:Myh4 UTSW 11 67,146,283 (GRCm39) missense probably null 0.12
PIT1430001:Myh4 UTSW 11 67,149,658 (GRCm39) missense probably benign 0.01
PIT4458001:Myh4 UTSW 11 67,131,821 (GRCm39) missense possibly damaging 0.56
R0099:Myh4 UTSW 11 67,150,173 (GRCm39) missense probably benign
R0194:Myh4 UTSW 11 67,143,162 (GRCm39) missense probably damaging 1.00
R0346:Myh4 UTSW 11 67,151,152 (GRCm39) missense probably benign
R0427:Myh4 UTSW 11 67,149,479 (GRCm39) missense probably damaging 0.98
R0483:Myh4 UTSW 11 67,143,123 (GRCm39) missense probably damaging 1.00
R0571:Myh4 UTSW 11 67,141,157 (GRCm39) missense possibly damaging 0.91
R0854:Myh4 UTSW 11 67,149,973 (GRCm39) missense possibly damaging 0.90
R0940:Myh4 UTSW 11 67,133,689 (GRCm39) missense probably damaging 1.00
R0946:Myh4 UTSW 11 67,142,577 (GRCm39) missense possibly damaging 0.70
R1108:Myh4 UTSW 11 67,146,532 (GRCm39) missense probably null 0.01
R1162:Myh4 UTSW 11 67,149,439 (GRCm39) missense probably damaging 0.97
R1194:Myh4 UTSW 11 67,146,560 (GRCm39) critical splice donor site probably null
R1347:Myh4 UTSW 11 67,135,567 (GRCm39) splice site probably benign
R1457:Myh4 UTSW 11 67,139,287 (GRCm39) missense probably damaging 0.99
R1531:Myh4 UTSW 11 67,141,366 (GRCm39) missense probably benign 0.01
R1716:Myh4 UTSW 11 67,141,135 (GRCm39) missense possibly damaging 0.92
R1766:Myh4 UTSW 11 67,147,121 (GRCm39) missense possibly damaging 0.61
R1796:Myh4 UTSW 11 67,151,150 (GRCm39) missense probably benign
R1856:Myh4 UTSW 11 67,146,508 (GRCm39) missense probably damaging 1.00
R1873:Myh4 UTSW 11 67,145,569 (GRCm39) missense probably benign 0.16
R2069:Myh4 UTSW 11 67,137,192 (GRCm39) splice site probably benign
R2370:Myh4 UTSW 11 67,146,454 (GRCm39) missense probably damaging 1.00
R2406:Myh4 UTSW 11 67,150,000 (GRCm39) missense probably damaging 1.00
R2414:Myh4 UTSW 11 67,141,594 (GRCm39) missense probably benign 0.01
R2848:Myh4 UTSW 11 67,139,459 (GRCm39) missense probably benign 0.20
R3111:Myh4 UTSW 11 67,137,276 (GRCm39) missense possibly damaging 0.86
R3744:Myh4 UTSW 11 67,146,141 (GRCm39) missense probably damaging 1.00
R3845:Myh4 UTSW 11 67,149,931 (GRCm39) missense possibly damaging 0.90
R3877:Myh4 UTSW 11 67,148,009 (GRCm39) missense probably benign 0.00
R4498:Myh4 UTSW 11 67,142,578 (GRCm39) missense probably damaging 1.00
R4514:Myh4 UTSW 11 67,146,395 (GRCm39) missense probably benign 0.06
R4601:Myh4 UTSW 11 67,141,136 (GRCm39) missense possibly damaging 0.94
R4673:Myh4 UTSW 11 67,137,227 (GRCm39) missense probably benign 0.02
R4736:Myh4 UTSW 11 67,131,746 (GRCm39) missense probably benign 0.01
R4837:Myh4 UTSW 11 67,149,818 (GRCm39) missense probably benign 0.38
R4866:Myh4 UTSW 11 67,139,453 (GRCm39) missense probably benign 0.00
R4869:Myh4 UTSW 11 67,143,490 (GRCm39) missense probably damaging 1.00
R4887:Myh4 UTSW 11 67,131,880 (GRCm39) missense probably damaging 0.99
R4921:Myh4 UTSW 11 67,144,854 (GRCm39) missense probably damaging 1.00
R5005:Myh4 UTSW 11 67,144,241 (GRCm39) missense probably benign 0.05
R5008:Myh4 UTSW 11 67,144,358 (GRCm39) missense probably benign 0.00
R5011:Myh4 UTSW 11 67,147,189 (GRCm39) missense probably benign 0.03
R5087:Myh4 UTSW 11 67,146,235 (GRCm39) missense probably damaging 1.00
R5277:Myh4 UTSW 11 67,143,180 (GRCm39) missense probably damaging 1.00
R5336:Myh4 UTSW 11 67,150,017 (GRCm39) splice site probably null
R5354:Myh4 UTSW 11 67,146,551 (GRCm39) missense possibly damaging 0.69
R5371:Myh4 UTSW 11 67,150,150 (GRCm39) missense probably damaging 1.00
R5484:Myh4 UTSW 11 67,142,644 (GRCm39) missense probably damaging 1.00
R5774:Myh4 UTSW 11 67,144,034 (GRCm39) nonsense probably null
R5902:Myh4 UTSW 11 67,141,733 (GRCm39) missense possibly damaging 0.69
R5941:Myh4 UTSW 11 67,150,126 (GRCm39) missense probably damaging 0.99
R6045:Myh4 UTSW 11 67,135,550 (GRCm39) missense probably benign 0.32
R6156:Myh4 UTSW 11 67,141,618 (GRCm39) missense probably benign 0.00
R6301:Myh4 UTSW 11 67,146,159 (GRCm39) missense possibly damaging 0.95
R6318:Myh4 UTSW 11 67,134,268 (GRCm39) missense probably benign 0.02
R6352:Myh4 UTSW 11 67,143,108 (GRCm39) missense probably damaging 1.00
R6385:Myh4 UTSW 11 67,146,663 (GRCm39) missense probably damaging 1.00
R6493:Myh4 UTSW 11 67,149,455 (GRCm39) missense probably benign 0.16
R6666:Myh4 UTSW 11 67,142,638 (GRCm39) missense probably damaging 1.00
R6826:Myh4 UTSW 11 67,137,357 (GRCm39) missense probably damaging 1.00
R6852:Myh4 UTSW 11 67,143,794 (GRCm39) splice site probably null
R6857:Myh4 UTSW 11 67,140,711 (GRCm39) missense possibly damaging 0.74
R7029:Myh4 UTSW 11 67,137,251 (GRCm39) missense probably benign 0.40
R7076:Myh4 UTSW 11 67,143,999 (GRCm39) missense possibly damaging 0.85
R7145:Myh4 UTSW 11 67,151,054 (GRCm39) missense possibly damaging 0.54
R7179:Myh4 UTSW 11 67,135,550 (GRCm39) missense probably benign 0.32
R7365:Myh4 UTSW 11 67,133,674 (GRCm39) missense probably damaging 1.00
R7514:Myh4 UTSW 11 67,134,148 (GRCm39) critical splice donor site probably null
R7553:Myh4 UTSW 11 67,147,221 (GRCm39) missense probably damaging 0.99
R7666:Myh4 UTSW 11 67,147,107 (GRCm39) missense probably damaging 0.99
R7673:Myh4 UTSW 11 67,136,339 (GRCm39) missense probably damaging 1.00
R7685:Myh4 UTSW 11 67,131,756 (GRCm39) missense probably benign 0.13
R8154:Myh4 UTSW 11 67,144,200 (GRCm39) missense probably damaging 1.00
R8343:Myh4 UTSW 11 67,143,390 (GRCm39) missense possibly damaging 0.45
R8446:Myh4 UTSW 11 67,144,347 (GRCm39) missense probably benign 0.14
R8534:Myh4 UTSW 11 67,134,335 (GRCm39) missense probably benign 0.17
R8710:Myh4 UTSW 11 67,143,158 (GRCm39) missense probably benign
R8775:Myh4 UTSW 11 67,148,006 (GRCm39) missense probably benign 0.25
R8775-TAIL:Myh4 UTSW 11 67,148,006 (GRCm39) missense probably benign 0.25
R8852:Myh4 UTSW 11 67,132,335 (GRCm39) missense probably damaging 1.00
R8860:Myh4 UTSW 11 67,132,335 (GRCm39) missense probably damaging 1.00
R8897:Myh4 UTSW 11 67,137,362 (GRCm39) missense possibly damaging 0.90
R8954:Myh4 UTSW 11 67,143,806 (GRCm39) missense possibly damaging 0.95
R8957:Myh4 UTSW 11 67,141,780 (GRCm39) missense possibly damaging 0.78
R9065:Myh4 UTSW 11 67,139,573 (GRCm39) missense probably benign
R9280:Myh4 UTSW 11 67,146,135 (GRCm39) missense probably damaging 0.96
R9296:Myh4 UTSW 11 67,146,130 (GRCm39) missense possibly damaging 0.95
R9310:Myh4 UTSW 11 67,145,570 (GRCm39) missense probably damaging 1.00
R9314:Myh4 UTSW 11 67,151,141 (GRCm39) missense probably benign 0.01
R9462:Myh4 UTSW 11 67,141,811 (GRCm39) missense possibly damaging 0.93
R9516:Myh4 UTSW 11 67,141,129 (GRCm39) missense probably damaging 1.00
R9516:Myh4 UTSW 11 67,139,290 (GRCm39) missense probably damaging 0.99
R9773:Myh4 UTSW 11 67,137,263 (GRCm39) missense probably damaging 1.00
X0027:Myh4 UTSW 11 67,137,306 (GRCm39) missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67,147,097 (GRCm39) missense probably benign 0.02
Z1176:Myh4 UTSW 11 67,144,331 (GRCm39) missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67,139,467 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAACGGATGCTCTTCCTGAAG -3'
(R):5'- ATGGCCATCCTTTGAGACTCTC -3'

Sequencing Primer
(F):5'- GATGCTCTTCCTGAAGGTGTACAAC -3'
(R):5'- TGAGACTCTCTCTAGTCCTGAAAAC -3'
Posted On 2017-11-30