Incidental Mutation 'R4707:Sptbn4'
ID 500054
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Name spectrin beta, non-erythrocytic 4
Synonyms nmf261, 1700022P15Rik, SpbIV, ROSA62, 5830426A08Rik, dyn, neuroaxonal dystrophy, Spnb4
MMRRC Submission 041955-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R4707 (G1)
Quality Score 186
Status Not validated
Chromosome 7
Chromosomal Location 27055808-27147111 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27116431 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 456 (D456G)
Ref Sequence ENSEMBL: ENSMUSP00000132807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000172269]
AlphaFold E9PX29
Predicted Effect probably benign
Transcript: ENSMUST00000011895
AA Change: D456G

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: D456G

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172269
AA Change: D456G

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: D456G

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,224,544 (GRCm39) K450R probably damaging Het
Abcd2 T C 15: 91,043,385 (GRCm39) D601G probably benign Het
Abcf3 A G 16: 20,367,808 (GRCm39) K56E possibly damaging Het
Acaca T C 11: 84,203,680 (GRCm39) V1477A probably damaging Het
Adamts20 G A 15: 94,231,528 (GRCm39) P887L possibly damaging Het
Ahnak T G 19: 8,994,099 (GRCm39) S5128A probably benign Het
Ahsa2 C A 11: 23,443,162 (GRCm39) V197F probably benign Het
Ak9 C A 10: 41,221,456 (GRCm39) H402N probably benign Het
Alpk1 G T 3: 127,481,241 (GRCm39) N175K possibly damaging Het
Als2 A G 1: 59,254,472 (GRCm39) V295A probably benign Het
Ankrd16 A G 2: 11,783,608 (GRCm39) D70G probably damaging Het
Apob A T 12: 8,056,205 (GRCm39) K1562N probably damaging Het
Arfgap2 C A 2: 91,100,316 (GRCm39) S250R probably damaging Het
Arhgef10l C T 4: 140,264,194 (GRCm39) M671I possibly damaging Het
Atrnl1 A G 19: 57,617,590 (GRCm39) I122V probably damaging Het
B4galnt2 C T 11: 95,766,923 (GRCm39) probably null Het
C8a A G 4: 104,713,618 (GRCm39) Y171H probably damaging Het
Cacnb4 A G 2: 52,364,927 (GRCm39) V112A probably benign Het
Capn9 G T 8: 125,340,195 (GRCm39) C566F possibly damaging Het
Ccdc88a T A 11: 29,397,956 (GRCm39) S230T probably benign Het
Cd300c2 A T 11: 114,887,811 (GRCm39) F197Y probably benign Het
Chd5 A G 4: 152,445,039 (GRCm39) Y340C probably damaging Het
Chrd A T 16: 20,557,558 (GRCm39) I726F possibly damaging Het
Chrna10 G A 7: 101,762,426 (GRCm39) P255S possibly damaging Het
Clasp1 T A 1: 118,470,927 (GRCm39) Y197* probably null Het
Cyp2c69 C G 19: 39,837,852 (GRCm39) G410A probably benign Het
Cyp2e1 G A 7: 140,343,821 (GRCm39) V20I possibly damaging Het
Dapp1 T C 3: 137,638,928 (GRCm39) D225G probably benign Het
Dnah5 A T 15: 28,372,521 (GRCm39) D2924V probably damaging Het
Efcab12 A T 6: 115,791,510 (GRCm39) L554Q possibly damaging Het
Emsy T C 7: 98,246,311 (GRCm39) T228A possibly damaging Het
Evc2 G A 5: 37,579,204 (GRCm39) V1106I probably benign Het
Exoc8 G T 8: 125,624,209 (GRCm39) Q53K possibly damaging Het
Fbn2 A T 18: 58,189,344 (GRCm39) V1594D probably damaging Het
Fer1l4 T C 2: 155,887,543 (GRCm39) Y551C possibly damaging Het
Fhip1a G T 3: 85,595,877 (GRCm39) T115K probably damaging Het
Fmnl3 A G 15: 99,221,362 (GRCm39) M481T probably benign Het
Fras1 A G 5: 96,883,097 (GRCm39) N2543S probably damaging Het
Fsd2 T C 7: 81,209,428 (GRCm39) D138G probably damaging Het
Gda C T 19: 21,405,992 (GRCm39) V5I probably benign Het
Glt8d2 A T 10: 82,496,583 (GRCm39) D158E probably damaging Het
Gpx6 C T 13: 21,496,434 (GRCm39) Q3* probably null Het
Greb1l A G 18: 10,532,922 (GRCm39) M830V probably benign Het
Hnrnpul1 A C 7: 25,426,258 (GRCm39) V531G probably damaging Het
Ifi206 A T 1: 173,308,432 (GRCm39) H521Q probably benign Het
Igsf3 G C 3: 101,365,410 (GRCm39) R1127P probably benign Het
Il1rl1 A G 1: 40,489,348 (GRCm39) R367G probably damaging Het
Islr T C 9: 58,064,970 (GRCm39) D179G possibly damaging Het
Jcad G T 18: 4,649,338 (GRCm39) E70* probably null Het
Kcnd2 T C 6: 21,723,211 (GRCm39) I467T probably benign Het
Lrrc27 A G 7: 138,822,614 (GRCm39) T502A probably benign Het
Lrrtm3 T A 10: 63,923,781 (GRCm39) H462L probably benign Het
Mbd5 T C 2: 49,140,168 (GRCm39) L44S probably damaging Het
Mccc1 C A 3: 36,030,022 (GRCm39) M429I probably damaging Het
Mgam A T 6: 40,691,566 (GRCm39) probably null Het
Mipep T A 14: 61,109,552 (GRCm39) I643N probably damaging Het
Mmrn1 A T 6: 60,965,457 (GRCm39) I1162L probably benign Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mug1 G A 6: 121,861,600 (GRCm39) C1354Y probably damaging Het
Nbeal2 A T 9: 110,461,123 (GRCm39) S1647T probably benign Het
Ndufaf2 C G 13: 108,189,314 (GRCm39) A145P probably damaging Het
Nedd9 A T 13: 41,492,051 (GRCm39) probably null Het
Nr4a2 T A 2: 57,002,105 (GRCm39) H116L probably benign Het
Nwd2 A G 5: 63,951,665 (GRCm39) Y232C probably damaging Het
Odf4 A G 11: 68,817,514 (GRCm39) L58P probably damaging Het
Or2a20 T A 6: 43,193,883 (GRCm39) V12D probably benign Het
Or4a27 T A 2: 88,559,056 (GRCm39) M296L possibly damaging Het
Or4c116 A T 2: 88,942,576 (GRCm39) F93L probably damaging Het
Or4g17 T A 2: 111,209,990 (GRCm39) L215H probably damaging Het
Or7e165 C T 9: 19,694,596 (GRCm39) H18Y probably damaging Het
Or8g24 A G 9: 38,989,558 (GRCm39) V161A probably benign Het
Or8s5 G T 15: 98,238,659 (GRCm39) H70Q possibly damaging Het
Orc6 T A 8: 86,029,579 (GRCm39) I41K probably damaging Het
Pikfyve A G 1: 65,307,005 (GRCm39) T1798A probably benign Het
Prdx6b T C 2: 80,123,404 (GRCm39) L71P probably damaging Het
Prmt2 A G 10: 76,062,055 (GRCm39) I50T probably damaging Het
Ptdss1 T C 13: 67,143,482 (GRCm39) probably null Het
Pygl T C 12: 70,254,532 (GRCm39) T138A possibly damaging Het
Rab3c T C 13: 110,198,434 (GRCm39) E198G probably benign Het
Rbl2 A G 8: 91,812,196 (GRCm39) Y255C probably damaging Het
Rev3l T A 10: 39,699,393 (GRCm39) S1297T probably damaging Het
Rgma C A 7: 73,067,564 (GRCm39) T367K probably damaging Het
Rps6ka5 C T 12: 100,564,144 (GRCm39) probably null Het
Rslcan18 A T 13: 67,246,590 (GRCm39) C217S probably damaging Het
Rtp3 A G 9: 110,815,279 (GRCm39) probably benign Het
Ryr1 A T 7: 28,745,087 (GRCm39) N3848K probably damaging Het
Sema6a T A 18: 47,381,779 (GRCm39) T923S probably benign Het
Serpinb6d A T 13: 33,855,336 (GRCm39) T337S possibly damaging Het
Sf3b1 G A 1: 55,029,666 (GRCm39) T1112M probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sidt1 A T 16: 44,090,221 (GRCm39) Y369* probably null Het
Slc16a6 A G 11: 109,354,193 (GRCm39) S59P probably benign Het
Slc25a17 A C 15: 81,211,527 (GRCm39) L163W probably damaging Het
Slc44a3 T C 3: 121,320,723 (GRCm39) T93A possibly damaging Het
Sptbn1 T C 11: 30,087,197 (GRCm39) T1081A possibly damaging Het
Sycp1 C A 3: 102,760,805 (GRCm39) A703S possibly damaging Het
Tas2r118 T A 6: 23,969,225 (GRCm39) M279L probably benign Het
Tc2n T G 12: 101,660,832 (GRCm39) Q133H probably benign Het
Tctn1 A G 5: 122,399,468 (GRCm39) probably null Het
Tenm4 A C 7: 96,423,253 (GRCm39) K683Q probably damaging Het
Tex10 A T 4: 48,468,984 (GRCm39) S64T probably benign Het
Tex15 A G 8: 34,072,525 (GRCm39) T2691A probably benign Het
Tmem175 A T 5: 108,790,016 (GRCm39) T123S probably damaging Het
Tsc1 C A 2: 28,562,419 (GRCm39) S348R probably damaging Het
Ttll4 A T 1: 74,718,166 (GRCm39) T6S possibly damaging Het
Ttll8 A T 15: 88,801,293 (GRCm39) I465N probably damaging Het
Ubr3 A G 2: 69,768,714 (GRCm39) probably benign Het
Ugdh A T 5: 65,580,695 (GRCm39) probably null Het
Usp34 T C 11: 23,437,215 (GRCm39) L3326S probably damaging Het
Vmn2r125 A T 4: 156,702,276 (GRCm39) I21F probably damaging Het
Vps9d1 G A 8: 123,975,351 (GRCm39) probably benign Het
Xab2 G A 8: 3,668,117 (GRCm39) R154C possibly damaging Het
Zbtb12 T C 17: 35,114,475 (GRCm39) S87P probably damaging Het
Zc3h12a A G 4: 125,014,686 (GRCm39) M266T probably damaging Het
Zfp108 G A 7: 23,959,837 (GRCm39) A143T probably benign Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27,068,859 (GRCm39) missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27,117,390 (GRCm39) missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27,114,196 (GRCm39) missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27,103,693 (GRCm39) missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27,063,571 (GRCm39) missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27,063,940 (GRCm39) missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27,063,782 (GRCm39) missense probably benign
IGL02226:Sptbn4 APN 7 27,065,132 (GRCm39) missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27,063,724 (GRCm39) missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27,127,672 (GRCm39) missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27,065,014 (GRCm39) missense probably null 0.15
IGL02487:Sptbn4 APN 7 27,118,522 (GRCm39) missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27,090,976 (GRCm39) missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27,067,104 (GRCm39) missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27,126,258 (GRCm39) missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27,126,258 (GRCm39) missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27,093,573 (GRCm39) splice site probably benign
IGL02961:Sptbn4 APN 7 27,097,392 (GRCm39) missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27,056,812 (GRCm39) nonsense probably null
R0194:Sptbn4 UTSW 7 27,104,336 (GRCm39) missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27,059,161 (GRCm39) splice site probably benign
R0510:Sptbn4 UTSW 7 27,060,991 (GRCm39) critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27,063,803 (GRCm39) missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27,107,753 (GRCm39) nonsense probably null
R1336:Sptbn4 UTSW 7 27,117,388 (GRCm39) missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27,133,719 (GRCm39) missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27,118,164 (GRCm39) missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27,118,008 (GRCm39) missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27,066,071 (GRCm39) missense probably null 0.96
R1906:Sptbn4 UTSW 7 27,090,856 (GRCm39) critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27,106,563 (GRCm39) missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27,065,868 (GRCm39) missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27,067,127 (GRCm39) missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27,123,235 (GRCm39) missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27,065,844 (GRCm39) nonsense probably null
R2083:Sptbn4 UTSW 7 27,127,681 (GRCm39) missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27,063,587 (GRCm39) missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27,067,034 (GRCm39) missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27,133,782 (GRCm39) missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27,133,782 (GRCm39) missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27,059,517 (GRCm39) missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27,117,523 (GRCm39) nonsense probably null
R4115:Sptbn4 UTSW 7 27,090,995 (GRCm39) missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27,090,995 (GRCm39) missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27,117,896 (GRCm39) missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27,123,223 (GRCm39) missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27,067,127 (GRCm39) missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27,066,160 (GRCm39) missense possibly damaging 0.60
R4684:Sptbn4 UTSW 7 27,063,844 (GRCm39) missense probably damaging 0.96
R4876:Sptbn4 UTSW 7 27,071,577 (GRCm39) missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27,068,816 (GRCm39) missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27,059,166 (GRCm39) critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27,065,853 (GRCm39) missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27,118,138 (GRCm39) missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27,103,678 (GRCm39) missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27,071,596 (GRCm39) missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27,118,024 (GRCm39) missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27,063,904 (GRCm39) missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27,059,513 (GRCm39) missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27,064,012 (GRCm39) nonsense probably null
R6762:Sptbn4 UTSW 7 27,093,633 (GRCm39) missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27,071,375 (GRCm39) missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27,117,481 (GRCm39) missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27,116,210 (GRCm39) missense probably benign 0.44
R7465:Sptbn4 UTSW 7 27,066,114 (GRCm39) missense probably benign 0.00
R7471:Sptbn4 UTSW 7 27,108,439 (GRCm39) missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27,127,693 (GRCm39) missense probably benign 0.13
R7527:Sptbn4 UTSW 7 27,075,015 (GRCm39) missense possibly damaging 0.94
R7528:Sptbn4 UTSW 7 27,141,960 (GRCm39) missense probably benign 0.00
R7572:Sptbn4 UTSW 7 27,071,697 (GRCm39) missense probably damaging 0.99
R7649:Sptbn4 UTSW 7 27,061,002 (GRCm39) missense possibly damaging 0.80
R7714:Sptbn4 UTSW 7 27,063,761 (GRCm39) missense probably benign 0.02
R7780:Sptbn4 UTSW 7 27,061,059 (GRCm39) missense possibly damaging 0.70
R7854:Sptbn4 UTSW 7 27,061,835 (GRCm39) missense probably benign
R8002:Sptbn4 UTSW 7 27,117,417 (GRCm39) missense possibly damaging 0.91
R8058:Sptbn4 UTSW 7 27,063,694 (GRCm39) missense possibly damaging 0.92
R8181:Sptbn4 UTSW 7 27,074,808 (GRCm39) missense possibly damaging 0.79
R8195:Sptbn4 UTSW 7 27,108,314 (GRCm39) nonsense probably null
R8353:Sptbn4 UTSW 7 27,103,663 (GRCm39) missense probably damaging 1.00
R8392:Sptbn4 UTSW 7 27,071,721 (GRCm39) missense probably damaging 1.00
R8453:Sptbn4 UTSW 7 27,103,663 (GRCm39) missense probably damaging 1.00
R8815:Sptbn4 UTSW 7 27,106,657 (GRCm39) nonsense probably null
R8818:Sptbn4 UTSW 7 27,063,592 (GRCm39) missense possibly damaging 0.71
R9171:Sptbn4 UTSW 7 27,141,844 (GRCm39) missense possibly damaging 0.95
R9259:Sptbn4 UTSW 7 27,067,124 (GRCm39) missense possibly damaging 0.74
R9477:Sptbn4 UTSW 7 27,132,624 (GRCm39) missense possibly damaging 0.79
R9564:Sptbn4 UTSW 7 27,117,504 (GRCm39) missense probably damaging 0.98
R9572:Sptbn4 UTSW 7 27,066,095 (GRCm39) missense probably benign 0.16
R9623:Sptbn4 UTSW 7 27,107,807 (GRCm39) missense probably damaging 1.00
R9715:Sptbn4 UTSW 7 27,091,000 (GRCm39) missense probably damaging 1.00
R9782:Sptbn4 UTSW 7 27,107,993 (GRCm39) missense probably benign 0.02
R9790:Sptbn4 UTSW 7 27,071,662 (GRCm39) missense probably damaging 0.99
R9791:Sptbn4 UTSW 7 27,071,662 (GRCm39) missense probably damaging 0.99
R9798:Sptbn4 UTSW 7 27,056,717 (GRCm39) makesense probably null
X0020:Sptbn4 UTSW 7 27,102,159 (GRCm39) critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27,056,736 (GRCm39) unclassified probably benign
Z1176:Sptbn4 UTSW 7 27,059,450 (GRCm39) missense probably damaging 0.99
Z1177:Sptbn4 UTSW 7 27,108,527 (GRCm39) missense probably benign 0.41
Z1177:Sptbn4 UTSW 7 27,104,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCCAGATTCTGCTCAAG -3'
(R):5'- GGACTGATGTTTAAGATAACTGGG -3'

Sequencing Primer
(F):5'- AGATTCTGCTCAAGCCGGGTC -3'
(R):5'- TGATGTTTAAGATAACTGGGGAAGTG -3'
Posted On 2017-11-30