Incidental Mutation 'R5954:B4galnt3'
ID500086
Institutional Source Beutler Lab
Gene Symbol B4galnt3
Ensembl Gene ENSMUSG00000041372
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 3
Synonyms
MMRRC Submission 044143-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5954 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120203073-120294559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120225188 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 118 (F118L)
Ref Sequence ENSEMBL: ENSMUSP00000148759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057283] [ENSMUST00000212457]
Predicted Effect probably benign
Transcript: ENSMUST00000057283
AA Change: F118L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058253
Gene: ENSMUSG00000041372
AA Change: F118L

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
PA14 129 276 1.16e-21 SMART
low complexity region 591 612 N/A INTRINSIC
Pfam:CHGN 650 985 3.9e-29 PFAM
Pfam:Glyco_transf_7C 896 974 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125341
Predicted Effect possibly damaging
Transcript: ENSMUST00000212457
AA Change: F118L

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B4GALNT3 transfers N-acetylgalactosamine (GalNAc) onto glucosyl residues to form N,N-prime-diacetyllactosediamine (LacdiNAc, or LDN), a unique terminal structure of cell surface N-glycans (Ikehara et al., 2006 [PubMed 16728562]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,416 I944T probably benign Het
Ank2 T C 3: 126,997,861 T823A probably benign Het
Ankrd42 C G 7: 92,623,967 probably null Het
Anks4b T A 7: 120,182,173 N142K possibly damaging Het
Armc5 A G 7: 128,242,272 E484G probably benign Het
Bbs12 C T 3: 37,320,002 L200F possibly damaging Het
Cacna1h A G 17: 25,383,201 F1555S probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Chd6 A C 2: 160,965,827 H1822Q probably benign Het
Chdh C T 14: 30,031,181 R16C possibly damaging Het
Cnga1 T C 5: 72,604,878 D431G probably damaging Het
Dock8 G A 19: 25,171,619 R1487Q probably damaging Het
Farp1 T A 14: 121,222,667 V116D probably damaging Het
Fbxo24 T A 5: 137,619,681 T274S probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gatad2b T C 3: 90,351,441 L257P probably damaging Het
Gm20402 C T 3: 52,268,890 P30L probably damaging Het
Gm7932 C T 6: 48,862,859 noncoding transcript Het
Gpatch8 A T 11: 102,480,941 D590E unknown Het
Herc1 T G 9: 66,451,492 probably benign Het
Hsd3b2 T A 3: 98,711,559 I357F probably benign Het
Ipo5 A G 14: 120,919,984 Y78C probably damaging Het
Itga8 C A 2: 12,132,486 A23S probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat2a A G 11: 100,708,898 V451A possibly damaging Het
Knstrn A G 2: 118,830,955 probably benign Het
Med23 A G 10: 24,870,483 probably benign Het
Mefv A G 16: 3,715,715 Y231H probably benign Het
Olfr1425 A T 19: 12,074,083 I183N possibly damaging Het
Olfr1507 T A 14: 52,490,167 I266F probably benign Het
Olfr494 T A 7: 108,367,601 I37N probably damaging Het
Olfr935 A G 9: 38,995,415 S7P probably damaging Het
Pak7 G T 2: 136,116,463 T235K probably benign Het
Plppr3 G T 10: 79,866,126 P294Q probably benign Het
Prepl A G 17: 85,064,649 F725L probably benign Het
Ptchd3 A T 11: 121,836,587 probably benign Het
Rprd2 T C 3: 95,764,863 E1076G probably damaging Het
Sarm1 C A 11: 78,490,602 E352* probably null Het
Sccpdh T A 1: 179,680,588 H14Q probably benign Het
Senp7 A G 16: 56,169,871 I661V probably benign Het
Sept3 T C 15: 82,290,427 F140L probably damaging Het
Spag6 G T 2: 18,710,606 Q65H probably damaging Het
Tnni3 C T 7: 4,519,540 R137H probably damaging Het
Trank1 A G 9: 111,365,133 S742G probably benign Het
Ucn3 T C 13: 3,941,413 I80V probably benign Het
Ulk2 A T 11: 61,803,796 probably benign Het
Uncx C T 5: 139,547,629 S483L probably benign Het
Vps39 A G 2: 120,324,662 V550A probably damaging Het
Zfp697 C A 3: 98,428,593 T558K probably damaging Het
Zfp790 G T 7: 29,829,504 G538V probably damaging Het
Other mutations in B4galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:B4galnt3 APN 6 120215390 missense possibly damaging 0.87
IGL01543:B4galnt3 APN 6 120209312 missense probably benign 0.00
IGL02692:B4galnt3 APN 6 120210311 missense probably damaging 1.00
IGL03149:B4galnt3 APN 6 120231594 splice site probably benign
IGL03272:B4galnt3 APN 6 120216306 missense probably damaging 1.00
Minimus UTSW 6 120215057 missense probably benign
R0121:B4galnt3 UTSW 6 120215038 missense probably benign
R0414:B4galnt3 UTSW 6 120216565 missense probably benign 0.05
R1885:B4galnt3 UTSW 6 120223640 missense probably damaging 0.99
R1908:B4galnt3 UTSW 6 120210090 critical splice donor site probably null
R2264:B4galnt3 UTSW 6 120203810 makesense probably null
R4208:B4galnt3 UTSW 6 120215102 missense probably damaging 0.99
R4353:B4galnt3 UTSW 6 120215476 missense possibly damaging 0.89
R4649:B4galnt3 UTSW 6 120224620 missense probably damaging 1.00
R4874:B4galnt3 UTSW 6 120207206 missense probably damaging 1.00
R5046:B4galnt3 UTSW 6 120214798 missense probably damaging 1.00
R5232:B4galnt3 UTSW 6 120232988 missense probably damaging 1.00
R5431:B4galnt3 UTSW 6 120218967 missense probably damaging 1.00
R5447:B4galnt3 UTSW 6 120215057 missense probably benign
R5458:B4galnt3 UTSW 6 120210385 missense probably damaging 0.98
R5793:B4galnt3 UTSW 6 120208904 critical splice donor site probably null
R5985:B4galnt3 UTSW 6 120210158 missense probably damaging 1.00
R6156:B4galnt3 UTSW 6 120214840 missense probably benign 0.02
R6176:B4galnt3 UTSW 6 120224164 missense probably damaging 1.00
R6207:B4galnt3 UTSW 6 120206614 splice site probably null
R6565:B4galnt3 UTSW 6 120217479 nonsense probably null
R7153:B4galnt3 UTSW 6 120214968 missense probably benign 0.00
R7268:B4galnt3 UTSW 6 120215042 missense possibly damaging 0.92
R7307:B4galnt3 UTSW 6 120215431 missense probably benign 0.00
R7311:B4galnt3 UTSW 6 120215435 nonsense probably null
R7360:B4galnt3 UTSW 6 120232979 nonsense probably null
R7538:B4galnt3 UTSW 6 120294423 nonsense probably null
X0028:B4galnt3 UTSW 6 120231552 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGACCGACTGTGATGGACTGAG -3'
(R):5'- AACCTCAGAGTCAGGCCATAGG -3'

Sequencing Primer
(F):5'- CCGACTGTGATGGACTGAGAAGAAG -3'
(R):5'- GTGAGGATCCCAGTAATCCCTTCAG -3'
Posted On2017-11-30