Incidental Mutation 'R4914:Ece2'
List |< first << previous [record 23 of 100] next >> last >|
ID500089
Institutional Source Beutler Lab
Gene Symbol Ece2
Ensembl Gene ENSMUSG00000022842
Gene Nameendothelin converting enzyme 2
Synonyms1810009K13Rik, 9630025D12Rik, 6330509A19Rik
MMRRC Submission 042516-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4914 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20629828-20646485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20644070 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 582 (R582C)
Ref Sequence ENSEMBL: ENSMUSP00000119693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003898] [ENSMUST00000079600] [ENSMUST00000120394] [ENSMUST00000122306] [ENSMUST00000133344]
Predicted Effect probably damaging
Transcript: ENSMUST00000003898
AA Change: R611C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003898
Gene: ENSMUSG00000022842
AA Change: R611C

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Pfam:Peptidase_M13_N 115 500 8.3e-125 PFAM
Pfam:Peptidase_M13 559 762 1.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079600
AA Change: R729C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078550
Gene: ENSMUSG00000115293
AA Change: R729C

DomainStartEndE-ValueType
Pfam:Methyltransf_11 63 158 8.5e-8 PFAM
transmembrane domain 179 201 N/A INTRINSIC
Pfam:Peptidase_M13_N 233 618 1.2e-124 PFAM
Pfam:Peptidase_M13 677 880 1.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120394
AA Change: R758C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113475
Gene: ENSMUSG00000115293
AA Change: R758C

DomainStartEndE-ValueType
Pfam:Methyltransf_18 58 163 1.2e-8 PFAM
Pfam:Methyltransf_11 63 163 1.7e-9 PFAM
transmembrane domain 208 230 N/A INTRINSIC
Pfam:Peptidase_M13_N 262 647 5e-109 PFAM
Pfam:Peptidase_M13 706 909 9.4e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122306
AA Change: R611C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114039
Gene: ENSMUSG00000022842
AA Change: R611C

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Pfam:Peptidase_M13_N 115 500 6.9e-125 PFAM
Pfam:Peptidase_M13 559 709 6e-50 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000125971
AA Change: R371C
SMART Domains Protein: ENSMUSP00000120239
Gene: ENSMUSG00000022842
AA Change: R371C

DomainStartEndE-ValueType
Pfam:Peptidase_M13_N 1 261 1.3e-71 PFAM
Pfam:Peptidase_M13 320 482 3.4e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133344
AA Change: R582C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119693
Gene: ENSMUSG00000022842
AA Change: R582C

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:Peptidase_M13_N 86 471 7.5e-125 PFAM
Pfam:Peptidase_M13 530 733 1e-66 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121231
Gene: ENSMUSG00000022842
AA Change: R672C

DomainStartEndE-ValueType
Pfam:Methyltransf_18 2 105 1.1e-8 PFAM
Pfam:Methyltransf_11 7 103 1.7e-9 PFAM
transmembrane domain 123 145 N/A INTRINSIC
Pfam:Peptidase_M13_N 177 562 4e-109 PFAM
Pfam:Peptidase_M13 621 824 8e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231739
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M13 family, which includes type 2 integral membrane metallopeptidases. The encoded enzyme is a membrane-bound zinc-dependent metalloprotease. The enzyme catalyzes the cleavage of big endothelin to produce the vasoconstrictor endothelin-1, and plays a role in the processing of several neuroendocrine peptides. It may also have methyltransferase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice develop normally, are viable and healthy, and exhibit normal fertility in both sexes, as well as a normal life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A G 5: 109,678,530 S59P probably damaging Het
Ace G A 11: 105,979,597 V281M probably damaging Het
Ap1b1 C T 11: 5,024,400 T363I possibly damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arhgef1 T A 7: 24,923,839 L436Q probably damaging Het
Atxn2 T A 5: 121,749,096 D276E probably damaging Het
AU040320 A T 4: 126,835,676 K544* probably null Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A G 13: 100,056,336 V1330A probably benign Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cabs1 T C 5: 87,980,437 Y316H probably damaging Het
Carmil2 A G 8: 105,693,543 K908E possibly damaging Het
Ccdc188 C A 16: 18,218,219 P86Q probably benign Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dclk2 A T 3: 86,824,742 probably null Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dpp4 A T 2: 62,347,892 M632K probably benign Het
E030030I06Rik G A 10: 22,114,298 T192M possibly damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Emc1 C T 4: 139,375,165 R924* probably null Het
Etaa1 A T 11: 17,946,532 S528R probably benign Het
Exoc2 A T 13: 30,876,813 N569K probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw16 C T 9: 109,438,177 V329I probably benign Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fermt1 A G 2: 132,906,840 V621A probably damaging Het
Fnbp4 A G 2: 90,751,169 T189A probably benign Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
G6pd2 T A 5: 61,810,329 Y482* probably null Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gper1 A G 5: 139,426,868 I323V probably benign Het
Grm5 C A 7: 88,130,129 R958S probably benign Het
H2-DMb2 A G 17: 34,150,529 T85A probably benign Het
Hgsnat A G 8: 25,964,838 S220P probably damaging Het
Hspa12a A T 19: 58,799,452 M646K probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Jmjd1c A G 10: 67,218,971 N344D probably damaging Het
Kif1c A G 11: 70,708,855 E471G probably damaging Het
Lalba T A 15: 98,482,180 N63I probably benign Het
Mcoln1 T A 8: 3,507,483 L163* probably null Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mpzl2 T A 9: 45,043,848 D114E probably benign Het
Myef2 T A 2: 125,109,739 K259* probably null Het
Myh8 C A 11: 67,292,684 D740E probably damaging Het
Myo1b A T 1: 51,824,208 probably null Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Olfr1369-ps1 A T 13: 21,116,397 Q235L probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr362 A T 2: 37,105,158 I164N possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Olfr90 T C 17: 37,085,991 Y58C probably damaging Het
Orc1 T C 4: 108,604,558 F584S probably damaging Het
Osgin1 C A 8: 119,442,544 A60D possibly damaging Het
Pde4dip C A 3: 97,715,328 V1522L probably benign Het
Phactr1 A G 13: 43,133,963 T556A possibly damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Ppp1r1a A G 15: 103,537,838 V14A probably damaging Het
Prkcd A T 14: 30,605,438 probably null Het
Ranbp17 T C 11: 33,213,425 S1082G probably benign Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rnf103 T A 6: 71,510,264 F626L possibly damaging Het
Rsrc2 A G 5: 123,739,550 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slain2 T A 5: 72,958,266 M448K probably benign Het
Slc25a54 T C 3: 109,111,079 F292L probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slco1b2 G A 6: 141,669,370 V334I probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Smg8 T C 11: 87,080,710 E745G probably damaging Het
Smyd1 T G 6: 71,219,337 I322L probably benign Het
Snx13 G A 12: 35,132,033 V694I possibly damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spag6 A T 2: 18,745,549 I469F probably benign Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Srprb C A 9: 103,201,948 V747L possibly damaging Het
Stam A G 2: 14,102,416 E16G probably damaging Het
Taar5 A T 10: 23,971,570 I289F possibly damaging Het
Tgif1 C T 17: 70,845,247 R70H probably damaging Het
Tmem2 G A 19: 21,809,289 V472I probably benign Het
Top2a A T 11: 99,002,960 L1036H probably damaging Het
Tph1 T A 7: 46,653,859 I232F probably damaging Het
Ttn T C 2: 76,746,831 T24573A probably damaging Het
Tub C T 7: 109,020,954 R102* probably null Het
Ube2n T A 10: 95,541,745 W129R possibly damaging Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Vmn2r81 A T 10: 79,270,523 K445M probably null Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Wdr63 A G 3: 146,066,827 I488T probably damaging Het
Zfp157 T C 5: 138,456,295 S252P possibly damaging Het
Zfp605 T A 5: 110,127,701 C228* probably null Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Ece2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Ece2 APN 16 20632794 missense possibly damaging 0.88
IGL01644:Ece2 APN 16 20617866 missense possibly damaging 0.93
IGL02414:Ece2 APN 16 20640706 missense probably damaging 1.00
IGL02754:Ece2 APN 16 20632648 missense probably damaging 1.00
IGL03368:Ece2 APN 16 20644158 missense possibly damaging 0.95
IGL03383:Ece2 APN 16 20633097 missense possibly damaging 0.90
R0063:Ece2 UTSW 16 20642317 missense probably benign
R0063:Ece2 UTSW 16 20642317 missense probably benign
R0750:Ece2 UTSW 16 20633050 missense probably benign 0.00
R1304:Ece2 UTSW 16 20611782 missense probably damaging 1.00
R1500:Ece2 UTSW 16 20644242 missense probably damaging 1.00
R1539:Ece2 UTSW 16 20642513 missense probably damaging 1.00
R1667:Ece2 UTSW 16 20637838 missense possibly damaging 0.78
R1702:Ece2 UTSW 16 20631246 missense probably damaging 0.99
R1903:Ece2 UTSW 16 20645172 missense probably damaging 0.99
R1937:Ece2 UTSW 16 20617866 missense probably damaging 0.99
R2014:Ece2 UTSW 16 20642317 missense probably benign
R4393:Ece2 UTSW 16 20632848 missense probably damaging 1.00
R4678:Ece2 UTSW 16 20640718 missense probably damaging 1.00
R4839:Ece2 UTSW 16 20631168 missense probably damaging 1.00
R4857:Ece2 UTSW 16 20617806 missense probably damaging 1.00
R4871:Ece2 UTSW 16 20644155 missense probably damaging 1.00
R4903:Ece2 UTSW 16 20631222 nonsense probably null
R5119:Ece2 UTSW 16 20618631 missense probably damaging 0.98
R5218:Ece2 UTSW 16 20618540 missense probably benign 0.06
R5642:Ece2 UTSW 16 20643727 missense probably benign 0.42
R5911:Ece2 UTSW 16 20638760 missense probably damaging 1.00
R6037:Ece2 UTSW 16 20630362 missense probably damaging 1.00
R6037:Ece2 UTSW 16 20630362 missense probably damaging 1.00
R6253:Ece2 UTSW 16 20639182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGACACATGCCTTTGATGACC -3'
(R):5'- AAGGACCCTTCGACACAGTC -3'

Sequencing Primer
(F):5'- CACATGCCTTTGATGACCAAGGTAG -3'
(R):5'- CTCACATTGTAAGCAGCCTTAAGG -3'
Posted On2017-11-30