Incidental Mutation 'R5671:Lmbr1l'
ID 500092
Institutional Source Beutler Lab
Gene Symbol Lmbr1l
Ensembl Gene ENSMUSG00000022999
Gene Name limb region 1 like
Synonyms D15Ertd735e, 1110013E13Rik
MMRRC Submission 043314-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5671 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 98801798-98815944 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 98805489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 337 (D337E)
Ref Sequence ENSEMBL: ENSMUSP00000023736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023736] [ENSMUST00000109127]
AlphaFold Q9D1E5
Predicted Effect possibly damaging
Transcript: ENSMUST00000023736
AA Change: D337E

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023736
Gene: ENSMUSG00000022999
AA Change: D337E

DomainStartEndE-ValueType
Pfam:LMBR1 28 269 2e-41 PFAM
Pfam:LMBR1 266 450 1.2e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109127
SMART Domains Protein: ENSMUSP00000104755
Gene: ENSMUSG00000022999

DomainStartEndE-ValueType
Pfam:LMBR1 1 324 6.3e-110 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231087
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
Ak2 T A 4: 128,902,040 (GRCm39) F238I probably damaging Het
Akap8l T C 17: 32,557,266 (GRCm39) Y115C probably damaging Het
Alms1 T A 6: 85,606,190 (GRCm39) N2613K possibly damaging Het
Antxr1 C T 6: 87,194,255 (GRCm39) probably null Het
Ap3b1 A T 13: 94,664,765 (GRCm39) R901S unknown Het
Arhgap45 A G 10: 79,861,310 (GRCm39) E491G probably damaging Het
Capn11 C T 17: 45,950,600 (GRCm39) R293Q possibly damaging Het
Cdx1 C T 18: 61,152,971 (GRCm39) V212I probably benign Het
Clca4b G A 3: 144,627,624 (GRCm39) T449I probably benign Het
Clec14a T C 12: 58,314,612 (GRCm39) I337V probably benign Het
Clip4 A C 17: 72,096,878 (GRCm39) M1L probably damaging Het
Exoc3l4 T C 12: 111,389,851 (GRCm39) I142T probably damaging Het
Flnb T A 14: 7,890,843 (GRCm38) I575N probably benign Het
Gad1-ps A T 10: 99,280,395 (GRCm39) noncoding transcript Het
Golga7 C T 8: 23,740,360 (GRCm39) A57T probably damaging Het
Gpa33 A G 1: 165,974,360 (GRCm39) T66A possibly damaging Het
Gpr141b A G 13: 19,913,465 (GRCm39) noncoding transcript Het
Gpr45 A G 1: 43,072,218 (GRCm39) Y287C probably damaging Het
H2-Eb1 C A 17: 34,533,229 (GRCm39) Y150* probably null Het
Hsd17b8 T C 17: 34,245,435 (GRCm39) D233G probably null Het
Ifna6 A T 4: 88,745,906 (GRCm39) Q85L probably damaging Het
Igkv9-120 G A 6: 68,027,257 (GRCm39) W57* probably null Het
Ivns1abp G T 1: 151,229,760 (GRCm39) L149F probably benign Het
Kank4 A G 4: 98,653,698 (GRCm39) probably null Het
Lama2 A T 10: 27,066,540 (GRCm39) C1114S probably damaging Het
Ly75 T C 2: 60,138,655 (GRCm39) D1404G probably damaging Het
Muc4 A G 16: 32,575,011 (GRCm39) T1199A probably benign Het
Nalcn A G 14: 123,532,818 (GRCm39) I1314T probably damaging Het
Nhlrc1 A G 13: 47,167,193 (GRCm39) F355L probably benign Het
Or2y16 T C 11: 49,335,140 (GRCm39) V154A probably benign Het
Or4k39 C T 2: 111,238,818 (GRCm39) noncoding transcript Het
Or5b21 A T 19: 12,839,171 (GRCm39) T11S probably benign Het
Pcsk1 A G 13: 75,246,026 (GRCm39) T135A possibly damaging Het
Ptpru T A 4: 131,547,501 (GRCm39) Y112F possibly damaging Het
Rbbp8 A G 18: 11,875,699 (GRCm39) S871G probably benign Het
Rhoj A T 12: 75,440,743 (GRCm39) I135F probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Semp2l2b T A 10: 21,942,742 (GRCm39) T413S possibly damaging Het
Ska1 G T 18: 74,330,067 (GRCm39) D224E probably damaging Het
Slc11a2 A G 15: 100,301,169 (GRCm39) Y295H probably damaging Het
Slc22a28 A T 19: 8,108,795 (GRCm39) C116S probably damaging Het
Synpo T C 18: 60,729,022 (GRCm39) D1060G probably damaging Het
Tectb T C 19: 55,181,059 (GRCm39) S310P probably benign Het
Tmc6 A G 11: 117,666,441 (GRCm39) S288P possibly damaging Het
Tpo A G 12: 30,169,490 (GRCm39) S82P probably benign Het
Ttyh3 T A 5: 140,617,307 (GRCm39) M321L probably benign Het
Usp8 A G 2: 126,584,345 (GRCm39) D518G probably benign Het
Vmn2r11 A G 5: 109,202,772 (GRCm39) W102R probably benign Het
Vps13a G A 19: 16,692,464 (GRCm39) H817Y probably benign Het
Vps51 A G 19: 6,118,224 (GRCm39) V757A probably benign Het
Washc4 T C 10: 83,405,892 (GRCm39) S463P probably damaging Het
Zfp423 T C 8: 88,508,955 (GRCm39) N442S probably damaging Het
Other mutations in Lmbr1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Lmbr1l APN 15 98,802,666 (GRCm39) missense probably damaging 1.00
IGL02097:Lmbr1l APN 15 98,815,772 (GRCm39) missense probably damaging 0.98
IGL02731:Lmbr1l APN 15 98,815,777 (GRCm39) missense probably damaging 0.96
finch UTSW 15 98,807,267 (GRCm39) critical splice donor site probably null
Gooseberry UTSW 15 98,810,308 (GRCm39) missense probably damaging 0.99
junco UTSW 15 98,810,408 (GRCm39) missense probably damaging 1.00
morula UTSW 15 98,802,672 (GRCm39) missense probably damaging 1.00
munia UTSW 15 98,807,150 (GRCm39) critical splice acceptor site probably null
strawberry UTSW 15 98,807,144 (GRCm39) nonsense probably null
R0310:Lmbr1l UTSW 15 98,806,654 (GRCm39) splice site probably benign
R1778:Lmbr1l UTSW 15 98,810,357 (GRCm39) missense probably damaging 1.00
R2418:Lmbr1l UTSW 15 98,805,418 (GRCm39) missense possibly damaging 0.89
R2419:Lmbr1l UTSW 15 98,805,418 (GRCm39) missense possibly damaging 0.89
R4181:Lmbr1l UTSW 15 98,806,601 (GRCm39) missense possibly damaging 0.94
R4379:Lmbr1l UTSW 15 98,807,144 (GRCm39) nonsense probably null
R4472:Lmbr1l UTSW 15 98,804,178 (GRCm39) missense probably benign 0.02
R5290:Lmbr1l UTSW 15 98,810,123 (GRCm39) missense probably damaging 1.00
R5410:Lmbr1l UTSW 15 98,807,143 (GRCm39) missense probably damaging 1.00
R5436:Lmbr1l UTSW 15 98,802,672 (GRCm39) missense probably damaging 1.00
R5667:Lmbr1l UTSW 15 98,805,489 (GRCm39) missense possibly damaging 0.88
R5918:Lmbr1l UTSW 15 98,810,308 (GRCm39) missense probably damaging 0.99
R6735:Lmbr1l UTSW 15 98,807,121 (GRCm39) missense probably damaging 1.00
R6882:Lmbr1l UTSW 15 98,805,467 (GRCm39) missense probably damaging 0.99
R7131:Lmbr1l UTSW 15 98,804,204 (GRCm39) missense probably benign 0.05
R7136:Lmbr1l UTSW 15 98,809,372 (GRCm39) splice site probably null
R7169:Lmbr1l UTSW 15 98,807,075 (GRCm39) critical splice donor site probably benign
R7169:Lmbr1l UTSW 15 98,807,039 (GRCm39) frame shift probably null
R7336:Lmbr1l UTSW 15 98,811,468 (GRCm39) missense possibly damaging 0.94
R7541:Lmbr1l UTSW 15 98,807,267 (GRCm39) critical splice donor site probably null
R7603:Lmbr1l UTSW 15 98,806,572 (GRCm39) nonsense probably null
R7974:Lmbr1l UTSW 15 98,809,500 (GRCm39) missense probably benign 0.03
R8354:Lmbr1l UTSW 15 98,810,357 (GRCm39) missense probably damaging 1.00
R8454:Lmbr1l UTSW 15 98,810,357 (GRCm39) missense probably damaging 1.00
R8504:Lmbr1l UTSW 15 98,810,065 (GRCm39) missense probably damaging 0.97
R8933:Lmbr1l UTSW 15 98,807,150 (GRCm39) critical splice acceptor site probably null
R8974:Lmbr1l UTSW 15 98,810,408 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAAGTTAGATGAAGATATGTGG -3'
(R):5'- AGCAGGTGGATTGTCACGAG -3'

Sequencing Primer
(F):5'- ATGAAGATATGTGGCTGCCC -3'
(R):5'- AGAAGGCTGGATGGTCCTGGTGTTC -3'
Posted On 2017-12-01