Mutagenetix > Incidental Mutations

Incidental Mutation 'R0542:Hars'

50013

Institutional Source

Beutler Lab

Gene Symbol

Hars

Ensembl Gene

ENSMUSG00000001380

Gene Name

histidyl-tRNA synthetase

Synonyms

MMHRS

MMRRC Submission

038734-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R0542 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36766530-36783205 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 36771181 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 215 (R215H)

Ref Sequence

ENSEMBL: ENSMUSP00000001416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001416] [ENSMUST00000061522]

Predicted Effect

probably benign
Transcript: ENSMUST00000001416
AA Change: R215H

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000001416
Gene: ENSMUSG00000001380
AA Change: R215H

Domain	Start	End	E-Value	Type
WHEP-TRS	7	60	5.37e-11	SMART
Pfam:tRNA-synt_His	61	389	1.9e-41	PFAM
Pfam:HGTP_anticodon2	404	507	3.3e-12	PFAM
Pfam:HGTP_anticodon	410	501	4.4e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000061522

SMART Domains

Protein: ENSMUSP00000054412
Gene: ENSMUSG00000044595

Domain	Start	End	E-Value	Type
low complexity region	43	58	N/A	INTRINSIC
RRM	59	132	2.49e-10	SMART
RRM	139	214	3.01e-1	SMART
Pfam:DND1_DSRM	253	333	1.1e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124038

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155827

Meta Mutation Damage Score

0.2599

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	A	G	2: 148,782,172	N22S	probably benign	Het
Abhd12b	C	A	12: 70,163,495	N71K	possibly damaging	Het
Adgrl2	A	G	3: 148,859,218	I242T	probably damaging	Het
Adgrv1	A	G	13: 81,573,318	S714P	probably damaging	Het
Agap3	G	A	5: 24,500,186	R704Q	possibly damaging	Het
Ankrd11	T	C	8: 122,895,770	R448G	probably damaging	Het
Anks1b	T	C	10: 90,073,967		probably benign	Het
Caml	A	T	13: 55,623,161	Q24L	possibly damaging	Het
Cdc14b	G	A	13: 64,243,683	T124I	probably benign	Het
Clca2	A	G	3: 145,075,810		probably benign	Het
Col12a1	A	G	9: 79,605,328		probably null	Het
Crispld1	T	C	1: 17,746,768	V183A	possibly damaging	Het
Dhx40	C	T	11: 86,804,256		probably null	Het
Dmxl1	T	A	18: 49,893,694	D1956E	probably benign	Het
Dsc2	A	G	18: 20,051,226	V35A	probably damaging	Het
Dusp27	A	T	1: 166,101,284	M253K	possibly damaging	Het
Elovl2	A	G	13: 41,191,976		probably benign	Het
Gapvd1	T	C	2: 34,725,036		probably benign	Het
Gnaq	T	A	19: 16,219,618	I56N	probably damaging	Het
Gpr139	T	C	7: 119,145,083	D93G	probably benign	Het
Helz2	C	A	2: 181,232,089	W2204L	probably damaging	Het
Itgb6	A	T	2: 60,605,136	C757S	possibly damaging	Het
Kpnb1	G	A	11: 97,187,572	T5I	probably benign	Het
Krt82	T	C	15: 101,545,600		probably benign	Het
Lgals9	T	A	11: 78,969,720	K175N	possibly damaging	Het
Lrp2	A	G	2: 69,428,654	I4564T	probably benign	Het
Mblac1	A	G	5: 138,194,536	T47A	possibly damaging	Het
Med12l	G	A	3: 59,042,401	D182N	probably damaging	Het
Megf9	A	G	4: 70,435,348	I407T	probably benign	Het
Mtmr6	A	T	14: 60,292,129		probably null	Het
Mtor	A	G	4: 148,540,450	T2173A	probably benign	Het
Mzt1	A	T	14: 99,040,502		probably benign	Het
Narf	T	C	11: 121,252,864	L444P	probably damaging	Het
Nsd1	A	T	13: 55,260,458	Q1305L	possibly damaging	Het
Ntsr1	A	G	2: 180,542,581	Y359C	probably damaging	Het
Olfm1	A	G	2: 28,214,628	D159G	possibly damaging	Het
Olfr168	A	T	16: 19,529,982	*313R	probably null	Het
Pcdh1	C	T	18: 38,189,922	V953I	probably damaging	Het
Pcdhb11	A	T	18: 37,423,834	D739V	probably damaging	Het
Pdgfd	A	G	9: 6,359,769	N280S	probably damaging	Het
Per2	A	T	1: 91,438,332		probably null	Het
Pfkp	G	T	13: 6,621,992	C122*	probably null	Het
Plxna4	G	A	6: 32,192,297	R1322W	probably damaging	Het
Ppox	A	G	1: 171,279,244	L202P	probably damaging	Het
Ppp1r3e	G	A	14: 54,877,131	P58L	probably benign	Het
Prr23a2	A	C	9: 98,857,033	N148T	probably benign	Het
Psd	T	C	19: 46,314,210	T842A	probably damaging	Het
Ranbp2	C	T	10: 58,478,414	A1652V	probably benign	Het
Rragd	G	A	4: 33,007,103	V144M	probably damaging	Het
Sema6a	T	G	18: 47,248,576	D968A	probably damaging	Het
Slc30a5	A	T	13: 100,809,285		probably null	Het
Snx17	G	T	5: 31,196,551		probably null	Het
Syt14	G	T	1: 192,930,803	T563K	probably damaging	Het
Tada3	T	C	6: 113,375,214	K85E	probably damaging	Het
Tspear	T	C	10: 77,881,087	V532A	probably benign	Het
Ttc30b	A	G	2: 75,936,711	V566A	probably damaging	Het
Ttn	A	T	2: 76,893,109	C6426S	possibly damaging	Het
Unc79	T	C	12: 103,094,178		probably benign	Het
Usp19	A	G	9: 108,494,385		probably null	Het
Vav3	G	A	3: 109,527,430	D426N	probably damaging	Het
Vezt	T	C	10: 94,007,096		probably null	Het
Vldlr	G	T	19: 27,236,255	R114L	probably benign	Het
Wdr34	A	G	2: 30,031,825	V508A	probably damaging	Het
Wwc2	C	T	8: 47,868,379	V567I	unknown	Het
Zfp423	T	C	8: 87,780,609	T911A	probably damaging	Het
Zfp719	A	G	7: 43,589,253		probably null	Het
Zkscan16	A	T	4: 58,956,597	H293L	possibly damaging	Het
Zkscan6	A	C	11: 65,828,699	N515T	possibly damaging	Het
Znfx1	A	G	2: 167,055,655	S450P	probably damaging	Het

Other mutations in Hars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Hars	APN	18	36768172	missense	probably damaging	1.00
IGL01993:Hars	APN	18	36770212	missense	probably damaging	1.00
IGL03079:Hars	APN	18	36770503	missense	probably damaging	1.00
P0040:Hars	UTSW	18	36773575	missense	probably damaging	0.99
R0630:Hars	UTSW	18	36771389	missense	probably damaging	1.00
R1171:Hars	UTSW	18	36771414	missense	possibly damaging	0.81
R1711:Hars	UTSW	18	36771103	missense	probably damaging	1.00
R1744:Hars	UTSW	18	36770832	missense	probably benign	0.00
R1873:Hars	UTSW	18	36767241	missense	probably damaging	0.99
R3907:Hars	UTSW	18	36782716	missense	probably benign	0.00
R5193:Hars	UTSW	18	36767305	missense	possibly damaging	0.94
R5688:Hars	UTSW	18	36772316	missense	probably damaging	1.00
R6331:Hars	UTSW	18	36771332	missense	probably benign	0.19
R6349:Hars	UTSW	18	36783054	missense	probably benign	0.00
R6416:Hars	UTSW	18	36773590	missense	possibly damaging	0.95
R7075:Hars	UTSW	18	36772355	missense	possibly damaging	0.87
R7209:Hars	UTSW	18	36773540	missense	probably benign	0.14
R7409:Hars	UTSW	18	36770113	missense	probably damaging	1.00
R7538:Hars	UTSW	18	36771141	missense	probably benign	0.00
R7621:Hars	UTSW	18	36770423	missense	probably benign
R7764:Hars	UTSW	18	36770184	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCTCACCATGCTGCTGGACATAG -3'
(R):5'- CCATGATTCCTGATGCAGAGTGCC -3'

Sequencing Primer
(F):5'- TTAACATCTGCACTGGGGC -3'
(R):5'- TTCCTGATGCAGAGTGCCTAAAG -3'

Posted On

2013-06-12