Incidental Mutation 'R0542:Dmxl1'
ID 50017
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene Name Dmx-like 1
Synonyms C630007L23Rik
MMRRC Submission 038734-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R0542 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 49965737-50098540 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50026761 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1956 (D1956E)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041772
AA Change: D1956E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: D1956E

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180611
AA Change: D1956E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: D1956E

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181907
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b C A 12: 70,210,269 (GRCm39) N71K possibly damaging Het
Adgrl2 A G 3: 148,564,854 (GRCm39) I242T probably damaging Het
Adgrv1 A G 13: 81,721,437 (GRCm39) S714P probably damaging Het
Agap3 G A 5: 24,705,184 (GRCm39) R704Q possibly damaging Het
Ankrd11 T C 8: 123,622,509 (GRCm39) R448G probably damaging Het
Anks1b T C 10: 89,909,829 (GRCm39) probably benign Het
Caml A T 13: 55,770,974 (GRCm39) Q24L possibly damaging Het
Cdc14b G A 13: 64,391,497 (GRCm39) T124I probably benign Het
Clca3a2 A G 3: 144,781,571 (GRCm39) probably benign Het
Col12a1 A G 9: 79,512,610 (GRCm39) probably null Het
Crispld1 T C 1: 17,816,992 (GRCm39) V183A possibly damaging Het
Cstdc1 A G 2: 148,624,092 (GRCm39) N22S probably benign Het
Dhx40 C T 11: 86,695,082 (GRCm39) probably null Het
Dsc2 A G 18: 20,184,283 (GRCm39) V35A probably damaging Het
Dync2i2 A G 2: 29,921,837 (GRCm39) V508A probably damaging Het
Elovl2 A G 13: 41,345,452 (GRCm39) probably benign Het
Gapvd1 T C 2: 34,615,048 (GRCm39) probably benign Het
Gnaq T A 19: 16,196,982 (GRCm39) I56N probably damaging Het
Gpr139 T C 7: 118,744,306 (GRCm39) D93G probably benign Het
Hars1 C T 18: 36,904,234 (GRCm39) R215H probably benign Het
Helz2 C A 2: 180,873,882 (GRCm39) W2204L probably damaging Het
Ift70b A G 2: 75,767,055 (GRCm39) V566A probably damaging Het
Itgb6 A T 2: 60,435,480 (GRCm39) C757S possibly damaging Het
Kpnb1 G A 11: 97,078,398 (GRCm39) T5I probably benign Het
Krt82 T C 15: 101,454,035 (GRCm39) probably benign Het
Lgals9 T A 11: 78,860,546 (GRCm39) K175N possibly damaging Het
Lrp2 A G 2: 69,258,998 (GRCm39) I4564T probably benign Het
Mblac1 A G 5: 138,192,798 (GRCm39) T47A possibly damaging Het
Med12l G A 3: 58,949,822 (GRCm39) D182N probably damaging Het
Megf9 A G 4: 70,353,585 (GRCm39) I407T probably benign Het
Mtmr6 A T 14: 60,529,578 (GRCm39) probably null Het
Mtor A G 4: 148,624,907 (GRCm39) T2173A probably benign Het
Mzt1 A T 14: 99,277,938 (GRCm39) probably benign Het
Narf T C 11: 121,143,690 (GRCm39) L444P probably damaging Het
Nsd1 A T 13: 55,408,271 (GRCm39) Q1305L possibly damaging Het
Ntsr1 A G 2: 180,184,374 (GRCm39) Y359C probably damaging Het
Olfm1 A G 2: 28,104,640 (GRCm39) D159G possibly damaging Het
Or2l13b A T 16: 19,348,732 (GRCm39) *313R probably null Het
Pcdh1 C T 18: 38,322,975 (GRCm39) V953I probably damaging Het
Pcdhb11 A T 18: 37,556,887 (GRCm39) D739V probably damaging Het
Pdgfd A G 9: 6,359,769 (GRCm39) N280S probably damaging Het
Per2 A T 1: 91,366,054 (GRCm39) probably null Het
Pfkp G T 13: 6,672,028 (GRCm39) C122* probably null Het
Plxna4 G A 6: 32,169,232 (GRCm39) R1322W probably damaging Het
Ppox A G 1: 171,106,818 (GRCm39) L202P probably damaging Het
Ppp1r3e G A 14: 55,114,588 (GRCm39) P58L probably benign Het
Prr23a2 A C 9: 98,739,086 (GRCm39) N148T probably benign Het
Psd T C 19: 46,302,649 (GRCm39) T842A probably damaging Het
Ranbp2 C T 10: 58,314,236 (GRCm39) A1652V probably benign Het
Rragd G A 4: 33,007,103 (GRCm39) V144M probably damaging Het
Sema6a T G 18: 47,381,643 (GRCm39) D968A probably damaging Het
Slc30a5 A T 13: 100,945,793 (GRCm39) probably null Het
Snx17 G T 5: 31,353,895 (GRCm39) probably null Het
Styxl2 A T 1: 165,928,853 (GRCm39) M253K possibly damaging Het
Syt14 G T 1: 192,613,111 (GRCm39) T563K probably damaging Het
Tada3 T C 6: 113,352,175 (GRCm39) K85E probably damaging Het
Tspear T C 10: 77,716,921 (GRCm39) V532A probably benign Het
Ttn A T 2: 76,723,453 (GRCm39) C6426S possibly damaging Het
Unc79 T C 12: 103,060,437 (GRCm39) probably benign Het
Usp19 A G 9: 108,371,584 (GRCm39) probably null Het
Vav3 G A 3: 109,434,746 (GRCm39) D426N probably damaging Het
Vezt T C 10: 93,842,958 (GRCm39) probably null Het
Vldlr G T 19: 27,213,655 (GRCm39) R114L probably benign Het
Wwc2 C T 8: 48,321,414 (GRCm39) V567I unknown Het
Zfp423 T C 8: 88,507,237 (GRCm39) T911A probably damaging Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Zkscan16 A T 4: 58,956,597 (GRCm39) H293L possibly damaging Het
Zkscan6 A C 11: 65,719,525 (GRCm39) N515T possibly damaging Het
Znfx1 A G 2: 166,897,575 (GRCm39) S450P probably damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49,984,534 (GRCm39) missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 50,072,620 (GRCm39) missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 50,050,735 (GRCm39) missense probably benign 0.00
IGL00969:Dmxl1 APN 18 50,045,792 (GRCm39) missense probably benign 0.02
IGL01113:Dmxl1 APN 18 50,045,818 (GRCm39) missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49,990,401 (GRCm39) missense probably benign
IGL01475:Dmxl1 APN 18 50,004,781 (GRCm39) missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 50,054,005 (GRCm39) missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 50,095,272 (GRCm39) missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49,996,092 (GRCm39) missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49,997,935 (GRCm39) missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 50,011,449 (GRCm39) nonsense probably null
IGL01933:Dmxl1 APN 18 50,010,852 (GRCm39) missense probably benign 0.17
IGL01952:Dmxl1 APN 18 50,023,721 (GRCm39) missense probably benign 0.11
IGL02120:Dmxl1 APN 18 50,027,245 (GRCm39) missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 50,094,230 (GRCm39) missense probably benign 0.00
IGL02213:Dmxl1 APN 18 50,010,741 (GRCm39) splice site probably benign
IGL02261:Dmxl1 APN 18 49,973,566 (GRCm39) missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49,997,962 (GRCm39) missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49,992,187 (GRCm39) missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 50,011,247 (GRCm39) missense probably benign 0.01
IGL03258:Dmxl1 APN 18 50,053,960 (GRCm39) missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49,997,885 (GRCm39) missense probably benign
capture UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
carnivora UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
digestion UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
drowning UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
hibiscus UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
impound UTSW 18 50,026,316 (GRCm39) missense probably benign
pitcher UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 50,065,030 (GRCm39) missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 50,021,964 (GRCm39) splice site probably benign
R0027:Dmxl1 UTSW 18 50,090,362 (GRCm39) splice site probably benign
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0257:Dmxl1 UTSW 18 50,088,870 (GRCm39) splice site probably benign
R0349:Dmxl1 UTSW 18 50,012,349 (GRCm39) missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 50,012,429 (GRCm39) missense probably benign 0.14
R0511:Dmxl1 UTSW 18 50,024,534 (GRCm39) nonsense probably null
R0539:Dmxl1 UTSW 18 49,990,497 (GRCm39) splice site probably benign
R0587:Dmxl1 UTSW 18 50,068,374 (GRCm39) missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49,984,490 (GRCm39) splice site probably benign
R0744:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 50,026,469 (GRCm39) missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 50,026,678 (GRCm39) missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 50,026,292 (GRCm39) missense probably benign
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 50,021,920 (GRCm39) missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49,990,316 (GRCm39) missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49,985,434 (GRCm39) missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49,992,353 (GRCm39) critical splice donor site probably null
R1638:Dmxl1 UTSW 18 50,023,834 (GRCm39) nonsense probably null
R1646:Dmxl1 UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 50,067,704 (GRCm39) missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 50,036,055 (GRCm39) missense probably benign
R1732:Dmxl1 UTSW 18 50,026,511 (GRCm39) nonsense probably null
R1886:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1895:Dmxl1 UTSW 18 50,088,981 (GRCm39) splice site probably null
R1911:Dmxl1 UTSW 18 50,011,230 (GRCm39) missense probably benign 0.00
R2020:Dmxl1 UTSW 18 50,022,625 (GRCm39) nonsense probably null
R2116:Dmxl1 UTSW 18 50,011,884 (GRCm39) missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 50,050,698 (GRCm39) missense probably benign 0.00
R2206:Dmxl1 UTSW 18 50,027,161 (GRCm39) missense probably benign 0.12
R2216:Dmxl1 UTSW 18 50,026,990 (GRCm39) missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49,979,706 (GRCm39) missense probably benign 0.34
R2333:Dmxl1 UTSW 18 50,053,043 (GRCm39) splice site probably null
R2343:Dmxl1 UTSW 18 50,023,745 (GRCm39) missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 50,013,858 (GRCm39) missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49,997,029 (GRCm39) missense probably benign
R4033:Dmxl1 UTSW 18 49,984,498 (GRCm39) missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 50,094,264 (GRCm39) missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 50,011,084 (GRCm39) nonsense probably null
R4406:Dmxl1 UTSW 18 50,022,620 (GRCm39) missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49,981,828 (GRCm39) missense probably benign
R4454:Dmxl1 UTSW 18 50,026,399 (GRCm39) missense probably benign 0.01
R4459:Dmxl1 UTSW 18 50,094,283 (GRCm39) missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 50,095,248 (GRCm39) missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 50,011,698 (GRCm39) missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 50,011,088 (GRCm39) missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49,996,059 (GRCm39) missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49,984,543 (GRCm39) missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 50,090,348 (GRCm39) intron probably benign
R4885:Dmxl1 UTSW 18 50,011,862 (GRCm39) missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 50,028,194 (GRCm39) missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 50,003,990 (GRCm39) missense probably benign 0.00
R5177:Dmxl1 UTSW 18 50,026,651 (GRCm39) missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 50,084,302 (GRCm39) missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49,996,186 (GRCm39) critical splice donor site probably null
R5433:Dmxl1 UTSW 18 50,000,966 (GRCm39) splice site probably null
R5484:Dmxl1 UTSW 18 50,022,531 (GRCm39) missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49,997,545 (GRCm39) missense probably benign 0.04
R5633:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 50,024,693 (GRCm39) missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 50,027,324 (GRCm39) missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 50,065,008 (GRCm39) nonsense probably null
R5706:Dmxl1 UTSW 18 50,090,462 (GRCm39) critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R5876:Dmxl1 UTSW 18 50,004,051 (GRCm39) missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49,990,453 (GRCm39) missense probably benign 0.00
R6145:Dmxl1 UTSW 18 50,045,833 (GRCm39) missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 50,026,402 (GRCm39) missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49,996,082 (GRCm39) missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 50,035,434 (GRCm39) missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 50,004,799 (GRCm39) missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R6319:Dmxl1 UTSW 18 49,985,367 (GRCm39) missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49,997,645 (GRCm39) missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49,992,246 (GRCm39) missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 50,011,313 (GRCm39) missense probably benign 0.03
R6743:Dmxl1 UTSW 18 50,013,847 (GRCm39) missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 50,027,041 (GRCm39) missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49,985,355 (GRCm39) nonsense probably null
R6857:Dmxl1 UTSW 18 49,997,902 (GRCm39) missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 50,068,372 (GRCm39) missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49,976,851 (GRCm39) critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 50,053,969 (GRCm39) missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49,996,124 (GRCm39) missense possibly damaging 0.51
R6897:Dmxl1 UTSW 18 49,984,562 (GRCm39) missense probably null 0.99
R6917:Dmxl1 UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 50,088,920 (GRCm39) missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49,997,681 (GRCm39) missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 50,011,679 (GRCm39) missense probably benign 0.00
R7570:Dmxl1 UTSW 18 50,027,024 (GRCm39) missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 50,035,861 (GRCm39) missense probably benign
R7629:Dmxl1 UTSW 18 49,992,337 (GRCm39) missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 50,026,619 (GRCm39) missense probably benign
R7688:Dmxl1 UTSW 18 50,088,938 (GRCm39) missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49,979,685 (GRCm39) missense probably benign 0.00
R7712:Dmxl1 UTSW 18 50,026,528 (GRCm39) missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 50,011,382 (GRCm39) missense probably benign 0.00
R7834:Dmxl1 UTSW 18 50,054,044 (GRCm39) missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49,973,557 (GRCm39) missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 50,094,214 (GRCm39) missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 50,026,474 (GRCm39) missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 50,011,500 (GRCm39) missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 50,021,897 (GRCm39) missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49,976,878 (GRCm39) missense probably benign 0.17
R8371:Dmxl1 UTSW 18 50,031,781 (GRCm39) missense probably benign 0.08
R8402:Dmxl1 UTSW 18 50,011,409 (GRCm39) missense probably benign
R8402:Dmxl1 UTSW 18 50,011,393 (GRCm39) nonsense probably null
R8402:Dmxl1 UTSW 18 50,011,394 (GRCm39) missense probably benign 0.09
R8423:Dmxl1 UTSW 18 49,998,183 (GRCm39) missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 50,004,759 (GRCm39) nonsense probably null
R8702:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R8749:Dmxl1 UTSW 18 50,088,937 (GRCm39) missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 50,090,406 (GRCm39) missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 50,026,741 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49,997,575 (GRCm39) missense possibly damaging 0.96
R8978:Dmxl1 UTSW 18 50,055,679 (GRCm39) missense probably benign 0.37
R8987:Dmxl1 UTSW 18 50,026,919 (GRCm39) missense
R9011:Dmxl1 UTSW 18 49,997,240 (GRCm39) missense probably damaging 1.00
R9124:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9131:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9132:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9156:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9165:Dmxl1 UTSW 18 50,011,992 (GRCm39) missense probably damaging 1.00
R9244:Dmxl1 UTSW 18 50,026,316 (GRCm39) missense probably benign
R9254:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9262:Dmxl1 UTSW 18 49,976,919 (GRCm39) missense probably benign 0.03
R9335:Dmxl1 UTSW 18 49,992,187 (GRCm39) missense probably damaging 0.96
R9375:Dmxl1 UTSW 18 50,091,477 (GRCm39) missense probably damaging 1.00
R9379:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9434:Dmxl1 UTSW 18 50,010,788 (GRCm39) missense probably damaging 0.98
R9470:Dmxl1 UTSW 18 50,026,777 (GRCm39) missense possibly damaging 0.69
R9500:Dmxl1 UTSW 18 50,011,271 (GRCm39) missense probably damaging 1.00
R9507:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.94
R9617:Dmxl1 UTSW 18 49,998,228 (GRCm39) missense probably damaging 1.00
R9642:Dmxl1 UTSW 18 50,013,825 (GRCm39) missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 50,026,461 (GRCm39) missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49,997,435 (GRCm39) missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 50,052,966 (GRCm39) missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 50,054,032 (GRCm39) missense probably benign
Z1188:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTGCTAGTGCTCACCTAAAAGCTG -3'
(R):5'- GTTGGTAACGCAATTTCCCACCATC -3'

Sequencing Primer
(F):5'- TTGTCAAAGATGCCCAAAGTCAG -3'
(R):5'- CGGTGAGAATCTTCAAACATGCTC -3'
Posted On 2013-06-12