Incidental Mutation 'R1405:Vwa5b2'
ID500233
Institutional Source Beutler Lab
Gene Symbol Vwa5b2
Ensembl Gene ENSMUSG00000046613
Gene Namevon Willebrand factor A domain containing 5B2
SynonymsEG328644
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1405 (G1)
Quality Score220
Status Not validated
Chromosome16
Chromosomal Location20589471-20605377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20604316 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1021 (D1021E)
Ref Sequence ENSEMBL: ENSMUSP00000123727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045918] [ENSMUST00000096197] [ENSMUST00000123774] [ENSMUST00000147867] [ENSMUST00000159780] [ENSMUST00000231362] [ENSMUST00000231386] [ENSMUST00000231387] [ENSMUST00000231471] [ENSMUST00000231531] [ENSMUST00000231749] [ENSMUST00000231904] [ENSMUST00000232319] [ENSMUST00000232451] [ENSMUST00000232458]
Predicted Effect probably benign
Transcript: ENSMUST00000045918
SMART Domains Protein: ENSMUSP00000045272
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
Pfam:ALG3 47 406 2.5e-145 PFAM
low complexity region 407 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046188
Predicted Effect probably benign
Transcript: ENSMUST00000096197
AA Change: D1021E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000093911
Gene: ENSMUSG00000046613
AA Change: D1021E

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.3e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117019
Predicted Effect probably benign
Transcript: ENSMUST00000123774
SMART Domains Protein: ENSMUSP00000123378
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127454
SMART Domains Protein: ENSMUSP00000120559
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ALG3 51 118 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147867
Predicted Effect probably benign
Transcript: ENSMUST00000159780
AA Change: D1021E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123727
Gene: ENSMUSG00000046613
AA Change: D1021E

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 5.5e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231362
Predicted Effect probably benign
Transcript: ENSMUST00000231386
Predicted Effect probably benign
Transcript: ENSMUST00000231387
Predicted Effect probably benign
Transcript: ENSMUST00000231471
Predicted Effect probably benign
Transcript: ENSMUST00000231531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231608
Predicted Effect probably benign
Transcript: ENSMUST00000231749
Predicted Effect probably benign
Transcript: ENSMUST00000231904
Predicted Effect probably benign
Transcript: ENSMUST00000232319
Predicted Effect probably benign
Transcript: ENSMUST00000232451
Predicted Effect probably benign
Transcript: ENSMUST00000232458
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.7%
  • 10x: 83.5%
  • 20x: 53.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Vwa5b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Vwa5b2 APN 16 20604270 missense probably benign
IGL01543:Vwa5b2 APN 16 20595716 missense probably benign 0.02
IGL01719:Vwa5b2 APN 16 20597433 critical splice donor site probably null
IGL02006:Vwa5b2 APN 16 20597093 missense probably damaging 0.97
IGL02150:Vwa5b2 APN 16 20604826 missense probably benign
IGL02301:Vwa5b2 APN 16 20604790 missense probably damaging 1.00
IGL02373:Vwa5b2 APN 16 20604844 missense probably damaging 0.99
IGL02413:Vwa5b2 APN 16 20598101 missense probably damaging 1.00
IGL02664:Vwa5b2 APN 16 20595313 unclassified probably benign
R1171:Vwa5b2 UTSW 16 20604984 missense probably benign
R1405:Vwa5b2 UTSW 16 20604316 missense probably benign 0.00
R1464:Vwa5b2 UTSW 16 20596269 missense probably benign 0.08
R1464:Vwa5b2 UTSW 16 20596269 missense probably benign 0.08
R1730:Vwa5b2 UTSW 16 20600925 missense probably damaging 1.00
R1901:Vwa5b2 UTSW 16 20604832 missense possibly damaging 0.77
R1902:Vwa5b2 UTSW 16 20604832 missense possibly damaging 0.77
R1903:Vwa5b2 UTSW 16 20604832 missense possibly damaging 0.77
R1959:Vwa5b2 UTSW 16 20602191 critical splice donor site probably null
R1961:Vwa5b2 UTSW 16 20602191 critical splice donor site probably null
R3522:Vwa5b2 UTSW 16 20601608 missense probably damaging 0.99
R3687:Vwa5b2 UTSW 16 20591558 unclassified probably benign
R3746:Vwa5b2 UTSW 16 20598326 intron probably benign
R3747:Vwa5b2 UTSW 16 20598326 intron probably benign
R3749:Vwa5b2 UTSW 16 20598326 intron probably benign
R3952:Vwa5b2 UTSW 16 20598361 makesense probably null
R4641:Vwa5b2 UTSW 16 20604643 missense probably damaging 1.00
R4646:Vwa5b2 UTSW 16 20596329 missense probably damaging 1.00
R4772:Vwa5b2 UTSW 16 20600803 splice site probably null
R5032:Vwa5b2 UTSW 16 20600709 missense probably damaging 1.00
R5286:Vwa5b2 UTSW 16 20596308 missense probably damaging 1.00
R5569:Vwa5b2 UTSW 16 20595339 missense probably damaging 1.00
R5585:Vwa5b2 UTSW 16 20594678 nonsense probably null
R5640:Vwa5b2 UTSW 16 20597542 missense probably damaging 1.00
R6330:Vwa5b2 UTSW 16 20601977 missense probably damaging 1.00
R6459:Vwa5b2 UTSW 16 20594679 missense probably damaging 0.98
R6992:Vwa5b2 UTSW 16 20598202 missense probably damaging 1.00
R7102:Vwa5b2 UTSW 16 20604234 missense probably benign 0.00
R7231:Vwa5b2 UTSW 16 20604128 missense probably benign 0.00
R7591:Vwa5b2 UTSW 16 20601567 missense probably damaging 0.96
R7765:Vwa5b2 UTSW 16 20594611 missense probably benign
Z1176:Vwa5b2 UTSW 16 20591253 missense probably damaging 0.99
Z1177:Vwa5b2 UTSW 16 20600651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGGCACAGATGGGCTTTGGAC -3'
(R):5'- TGAGGAATGCACACAGCAGCAC -3'

Sequencing Primer
(F):5'- GCTTTGGACCACTTGCTG -3'
(R):5'- CTTGCAGTCGTACCTGAGGAG -3'
Posted On2017-12-01