Mutagenetix > Incidental Mutation

Incidental Mutation 'R0543:Kcnt2'

50026

Institutional Source

Beutler Lab

Gene Symbol

Kcnt2

Ensembl Gene

ENSMUSG00000052726

Gene Name

potassium channel, subfamily T, member 2

Synonyms

E330038N15Rik

MMRRC Submission

038735-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R0543 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140246158-140612067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 140609614 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 1037 (P1037T)

Ref Sequence

ENSEMBL: ENSMUSP00000113535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]

AlphaFold

D3Z649

Predicted Effect

probably damaging
Transcript: ENSMUST00000060201
AA Change: P1111T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054623
Gene: ENSMUSG00000052726
AA Change: P1111T

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	424	533	1.3e-31	PFAM
low complexity region	655	670	N/A	INTRINSIC
low complexity region	677	689	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119786
AA Change: P1037T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: P1037T

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.6e-15	PFAM
Pfam:BK_channel_a	422	476	2.3e-16	PFAM
low complexity region	598	613	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	699	714	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120709
AA Change: P1080T

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: P1080T

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.7e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC
low complexity region	749	764	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120796
AA Change: P1104T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: P1104T

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193820

Meta Mutation Damage Score

0.0849

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.3%

Validation Efficiency

99% (69/70)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500015O10Rik	C	A	1: 43,742,289	N110K	possibly damaging	Het
4930444G20Rik	T	C	10: 22,066,924	S386G	possibly damaging	Het
4932438A13Rik	G	A	3: 36,996,458	S2981N	probably benign	Het
Alox5	T	A	6: 116,454,317		probably null	Het
Apol9b	A	G	15: 77,735,640	N212S	probably damaging	Het
Ash1l	T	A	3: 89,063,778		probably null	Het
Ccdc180	A	T	4: 45,900,041	K200*	probably null	Het
Ccser2	A	T	14: 36,940,192	M345K	probably benign	Het
Cdcp2	A	T	4: 107,097,676		probably null	Het
Clca3a1	T	C	3: 144,748,394		probably benign	Het
Cntn3	G	A	6: 102,269,090		probably benign	Het
Col28a1	T	A	6: 8,075,326		probably benign	Het
Dock2	A	G	11: 34,294,325	F1035S	probably damaging	Het
Dsg1a	A	T	18: 20,340,863	S998C	probably damaging	Het
Enox1	T	C	14: 77,506,959		probably benign	Het
Fgfr3	A	G	5: 33,729,710	M1V	probably null	Het
Fuca2	T	A	10: 13,503,126	Y5N	probably damaging	Het
Git2	G	T	5: 114,745,531	H42Q	probably damaging	Het
Gm7964	G	A	7: 83,756,394		noncoding transcript	Het
Hars2	G	A	18: 36,789,424	E337K	probably damaging	Het
Hells	A	G	19: 38,967,750	R797G	probably benign	Het
Hnf1a	G	A	5: 114,950,744	S571L	probably benign	Het
Hoxa5	T	C	6: 52,204,340	Y4C	probably damaging	Het
Inpp4a	G	A	1: 37,369,492		probably benign	Het
Ints6	T	C	14: 62,696,611	I816V	probably damaging	Het
Itpr1	T	C	6: 108,515,748		probably benign	Het
Lyg2	T	A	1: 37,911,107	M47L	possibly damaging	Het
Macf1	G	T	4: 123,376,378	A4648D	probably damaging	Het
Mcf2l	T	C	8: 12,996,728		probably null	Het
Mcm9	C	T	10: 53,541,598	R3H	probably damaging	Het
Met	T	A	6: 17,491,970	Y244N	probably damaging	Het
Mettl14	A	T	3: 123,374,762	C210S	possibly damaging	Het
Mrgpra4	T	C	7: 47,981,310	Y181C	probably benign	Het
Mtch2	T	C	2: 90,849,682	V86A	possibly damaging	Het
Mttp	A	T	3: 138,111,696	I446N	possibly damaging	Het
Muc4	T	A	16: 32,756,746	S2207T	unknown	Het
Muc5b	A	G	7: 141,851,785	T944A	unknown	Het
Myo15	A	T	11: 60,479,051	H879L	probably benign	Het
Nkiras2	G	A	11: 100,624,192		probably benign	Het
Nostrin	T	G	2: 69,189,131	*507E	probably null	Het
Nup205	T	C	6: 35,198,969	V589A	probably benign	Het
Olfr1141	C	A	2: 87,753,650	L114F	probably damaging	Het
Olfr1444	G	T	19: 12,861,888	V38F	probably benign	Het
Olfr530	A	G	7: 140,373,394	I72T	probably benign	Het
Oxct2b	T	A	4: 123,116,989	M234K	possibly damaging	Het
Park2	G	A	17: 11,067,179	D20N	probably damaging	Het
Pcdha1	A	T	18: 37,185,068	I945F	probably damaging	Het
Pdzd3	A	C	9: 44,248,934	H324Q	probably damaging	Het
Pik3ca	G	A	3: 32,450,261		probably null	Het
Pkhd1l1	A	G	15: 44,523,491		probably null	Het
Plscr1	A	T	9: 92,258,046		probably null	Het
Psd	T	C	19: 46,319,517	E684G	possibly damaging	Het
Rab11fip3	T	C	17: 25,994,225	E870G	probably damaging	Het
Rpl22l1	C	A	3: 28,807,274	Y103*	probably null	Het
Slc38a4	A	T	15: 97,016,839	N44K	possibly damaging	Het
Slco6c1	T	A	1: 97,127,898	I93F	probably damaging	Het
Ssfa2	T	A	2: 79,644,506	S270T	possibly damaging	Het
Strip1	G	A	3: 107,626,775	T181M	possibly damaging	Het
Stxbp5l	G	A	16: 37,208,096	A535V	probably damaging	Het
Tg	A	T	15: 66,729,597	Q152L	probably benign	Het
Thada	T	C	17: 84,423,163	T1036A	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tns1	T	A	1: 73,952,697	T941S	probably benign	Het
Tppp3	T	C	8: 105,468,208	D97G	probably benign	Het
Trp53bp1	C	A	2: 121,251,868	A317S	probably null	Het
Trpm7	T	C	2: 126,848,529	I210V	probably damaging	Het
Ubr1	A	G	2: 120,881,093	L1440P	probably damaging	Het
Utp18	A	T	11: 93,875,835	Y317N	probably damaging	Het
Zdhhc5	T	A	2: 84,692,480		probably benign	Het
Zfp719	A	G	7: 43,589,253		probably null	Het

Other mutations in Kcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Kcnt2	APN	1	140523098	missense	probably damaging	1.00
IGL00673:Kcnt2	APN	1	140596051	missense	possibly damaging	0.60
IGL00806:Kcnt2	APN	1	140523211	missense	probably damaging	1.00
IGL01135:Kcnt2	APN	1	140354555	critical splice donor site	probably null	0.00
IGL01412:Kcnt2	APN	1	140570417	missense	probably benign	0.02
IGL01777:Kcnt2	APN	1	140595998	missense	probably benign	0.20
IGL01780:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02134:Kcnt2	APN	1	140376383	missense	probably benign
IGL02350:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02357:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02481:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02483:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02866:Kcnt2	APN	1	140425248	missense	probably damaging	1.00
IGL02891:Kcnt2	APN	1	140574806	missense	probably damaging	1.00
IGL03007:Kcnt2	APN	1	140354507	missense	possibly damaging	0.50
IGL03024:Kcnt2	APN	1	140570455	missense	probably benign	0.00
IGL03231:Kcnt2	APN	1	140534002	intron	probably benign
BB002:Kcnt2	UTSW	1	140354509	nonsense	probably null
BB012:Kcnt2	UTSW	1	140354509	nonsense	probably null
R0230:Kcnt2	UTSW	1	140246345	missense	probably benign	0.00
R0367:Kcnt2	UTSW	1	140351225	missense	probably damaging	1.00
R0486:Kcnt2	UTSW	1	140509480	nonsense	probably null
R0849:Kcnt2	UTSW	1	140507762	missense	probably damaging	1.00
R1123:Kcnt2	UTSW	1	140573608	missense	probably damaging	1.00
R1156:Kcnt2	UTSW	1	140428855	missense	probably damaging	1.00
R1425:Kcnt2	UTSW	1	140383028	missense	probably damaging	1.00
R1530:Kcnt2	UTSW	1	140484232	nonsense	probably null
R1546:Kcnt2	UTSW	1	140431378	missense	probably benign	0.01
R1728:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1729:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1730:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1739:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1762:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1783:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1784:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1785:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1862:Kcnt2	UTSW	1	140425330	missense	probably damaging	1.00
R1887:Kcnt2	UTSW	1	140584247	missense	probably damaging	0.99
R1889:Kcnt2	UTSW	1	140584293	missense	probably damaging	1.00
R1894:Kcnt2	UTSW	1	140425341	missense	probably damaging	1.00
R2005:Kcnt2	UTSW	1	140553018	missense	probably damaging	0.98
R2044:Kcnt2	UTSW	1	140375154	missense	probably benign	0.14
R2115:Kcnt2	UTSW	1	140552963	missense	probably damaging	1.00
R2135:Kcnt2	UTSW	1	140428813	missense	probably damaging	1.00
R2201:Kcnt2	UTSW	1	140509441	missense	probably damaging	1.00
R2212:Kcnt2	UTSW	1	140530800	missense	probably damaging	1.00
R2267:Kcnt2	UTSW	1	140573683	splice site	probably null
R2442:Kcnt2	UTSW	1	140376353	missense	possibly damaging	0.59
R3121:Kcnt2	UTSW	1	140428884	missense	probably damaging	0.97
R3176:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3276:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3704:Kcnt2	UTSW	1	140533968	missense	probably damaging	1.00
R3944:Kcnt2	UTSW	1	140584287	missense	probably damaging	1.00
R4164:Kcnt2	UTSW	1	140609630	missense	probably damaging	0.97
R4201:Kcnt2	UTSW	1	140425332	missense	probably damaging	0.98
R4501:Kcnt2	UTSW	1	140552980	missense	probably damaging	0.99
R4502:Kcnt2	UTSW	1	140507747	missense	probably damaging	0.99
R4632:Kcnt2	UTSW	1	140523148	missense	possibly damaging	0.90
R4758:Kcnt2	UTSW	1	140518897	missense	probably damaging	1.00
R4790:Kcnt2	UTSW	1	140354516	missense	probably damaging	0.99
R4892:Kcnt2	UTSW	1	140513025	nonsense	probably null
R4973:Kcnt2	UTSW	1	140609650	missense	probably damaging	1.00
R5154:Kcnt2	UTSW	1	140351256	missense	possibly damaging	0.94
R5296:Kcnt2	UTSW	1	140609615	missense	probably damaging	1.00
R5353:Kcnt2	UTSW	1	140426901	missense	probably damaging	1.00
R5605:Kcnt2	UTSW	1	140574743	missense	possibly damaging	0.59
R5806:Kcnt2	UTSW	1	140509496	missense	probably damaging	1.00
R5887:Kcnt2	UTSW	1	140425366	missense	probably damaging	1.00
R5917:Kcnt2	UTSW	1	140533928	missense	probably damaging	0.99
R5961:Kcnt2	UTSW	1	140507702	missense	possibly damaging	0.82
R6123:Kcnt2	UTSW	1	140362980	missense	probably damaging	1.00
R6225:Kcnt2	UTSW	1	140426923	nonsense	probably null
R6248:Kcnt2	UTSW	1	140509478	missense	probably damaging	1.00
R6351:Kcnt2	UTSW	1	140375112	missense	probably damaging	1.00
R6380:Kcnt2	UTSW	1	140509584	missense	probably damaging	1.00
R6532:Kcnt2	UTSW	1	140584106	missense	probably damaging	0.97
R6693:Kcnt2	UTSW	1	140351227	missense	probably benign	0.00
R6817:Kcnt2	UTSW	1	140246193	unclassified	probably benign
R6856:Kcnt2	UTSW	1	140596004	missense	probably damaging	1.00
R6944:Kcnt2	UTSW	1	140584065	missense	probably benign	0.00
R6971:Kcnt2	UTSW	1	140512908	missense	probably benign	0.01
R7052:Kcnt2	UTSW	1	140383047	missense	probably damaging	0.99
R7138:Kcnt2	UTSW	1	140596040	missense	possibly damaging	0.80
R7261:Kcnt2	UTSW	1	140354517	missense	possibly damaging	0.71
R7474:Kcnt2	UTSW	1	140570478	missense	possibly damaging	0.84
R7524:Kcnt2	UTSW	1	140584055	missense	probably damaging	0.99
R7541:Kcnt2	UTSW	1	140376384	missense	probably benign	0.09
R7558:Kcnt2	UTSW	1	140523190	missense	probably damaging	0.98
R7651:Kcnt2	UTSW	1	140570461	missense	probably benign	0.40
R7730:Kcnt2	UTSW	1	140518948	missense	probably benign	0.34
R7875:Kcnt2	UTSW	1	140573647	missense	probably damaging	1.00
R7883:Kcnt2	UTSW	1	140523150	missense	probably damaging	0.99
R7925:Kcnt2	UTSW	1	140354509	nonsense	probably null
R8040:Kcnt2	UTSW	1	140450217	missense	probably damaging	1.00
R8041:Kcnt2	UTSW	1	140609660	missense	probably benign
R8171:Kcnt2	UTSW	1	140509465	missense	probably benign	0.13
R8268:Kcnt2	UTSW	1	140523216	missense	probably damaging	0.99
R8905:Kcnt2	UTSW	1	140507729	missense	possibly damaging	0.65
R8927:Kcnt2	UTSW	1	140428797	splice site	probably null
R8988:Kcnt2	UTSW	1	140428849	missense	probably benign	0.38
R9020:Kcnt2	UTSW	1	140584311	missense	probably benign	0.23
R9109:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9167:Kcnt2	UTSW	1	140578462	missense	probably benign	0.11
R9232:Kcnt2	UTSW	1	140484193	missense	possibly damaging	0.56
R9297:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9298:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9318:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9404:Kcnt2	UTSW	1	140425369	missense	probably damaging	1.00
X0062:Kcnt2	UTSW	1	140512991	missense	possibly damaging	0.50
Z1088:Kcnt2	UTSW	1	140573646	missense	probably damaging	1.00
Z1088:Kcnt2	UTSW	1	140584158	nonsense	probably null
Z1176:Kcnt2	UTSW	1	140376361	missense	probably damaging	1.00
Z1177:Kcnt2	UTSW	1	140609648	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- GGAGCTTTGACCAATCGGAAATCTTCA -3'
(R):5'- GATTTTAAGCAAGATCCCTGCAAGGACT -3'

Sequencing Primer
(F):5'- aattgtcctggtcctcttagtg -3'
(R):5'- GATCCCTGCAAGGACTACAATG -3'

Posted On

2013-06-12