Incidental Mutation 'R1469:Sspo'
ID 500272
Institutional Source Beutler Lab
Gene Symbol Sspo
Ensembl Gene ENSMUSG00000029797
Gene Name SCO-spondin
Synonyms Scospondin, C79529
MMRRC Submission 039522-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1469 (G1)
Quality Score 168
Status Not validated
Chromosome 6
Chromosomal Location 48448229-48501250 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48490982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 4154 (C4154R)
Ref Sequence ENSEMBL: ENSMUSP00000047991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000169350] [ENSMUST00000185370] [ENSMUST00000188970] [ENSMUST00000212740]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043676
AA Change: C4154R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797
AA Change: C4154R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Pfam:VWD 154 219 7.4e-11 PFAM
C8 267 346 2.3e-10 SMART
Pfam:TIL 349 404 3.2e-13 PFAM
VWC 406 448 2e-1 SMART
VWD 433 593 5.08e-29 SMART
C8 631 703 2.14e-28 SMART
Pfam:TIL 706 759 5.8e-11 PFAM
VWC 856 924 4.76e-2 SMART
VWD 883 1042 9.59e-48 SMART
C8 1076 1150 3.62e-26 SMART
Pfam:TIL 1153 1209 2.6e-13 PFAM
LDLa 1253 1291 2.29e-13 SMART
LDLa 1293 1328 1.87e-9 SMART
LDLa 1329 1366 5.77e-10 SMART
LDLa 1369 1408 1.52e-9 SMART
LDLa 1442 1479 2.55e-11 SMART
LDLa 1480 1520 5.6e-8 SMART
LDLa 1533 1574 2.29e-4 SMART
TSP1 1575 1626 6.47e-13 SMART
TSP1 1631 1686 1.35e-10 SMART
Pfam:TIL 1690 1746 3.1e-9 PFAM
TSP1 1774 1827 6.94e-2 SMART
VWC 1829 1886 4.95e-9 SMART
low complexity region 1901 1911 N/A INTRINSIC
FA58C 1928 2085 1.4e-2 SMART
LDLa 2091 2128 1.48e-7 SMART
LDLa 2242 2279 5.68e-9 SMART
LDLa 2299 2336 5.77e-10 SMART
TSP1 2339 2389 1.42e-9 SMART
TSP1 2394 2446 6.36e-21 SMART
Pfam:TIL 2460 2511 5.7e-10 PFAM
VWC 2513 2567 2.48e-1 SMART
TSP1 2554 2605 3.07e-14 SMART
TSP1 2611 2664 4.05e-5 SMART
TSP1 2669 2719 1.83e-12 SMART
EGF_like 2733 2776 5.45e1 SMART
VWC 2783 2836 2.73e-11 SMART
TSP1 2823 2875 3.72e-13 SMART
TSP1 2878 2919 6.05e-4 SMART
Pfam:TIL 2926 2978 1.1e-11 PFAM
VWC 2980 3035 9.77e-2 SMART
TSP1 3022 3086 6.68e-6 SMART
TSP1 3091 3143 1.08e-14 SMART
Pfam:TIL 3147 3201 2.2e-9 PFAM
VWC 3203 3260 2.72e-1 SMART
TSP1 3247 3306 3.72e-4 SMART
TSP1 3311 3363 5.27e-4 SMART
Pfam:TIL 3365 3421 4.2e-9 PFAM
TSP1 3484 3529 1.87e-9 SMART
low complexity region 3591 3601 N/A INTRINSIC
TSP1 3660 3713 5.02e-10 SMART
TSP1 3730 3779 2.95e-7 SMART
TSP1 3796 3849 1.99e-13 SMART
TSP1 3854 3906 2.51e-10 SMART
Pfam:TIL 3909 3964 3.4e-11 PFAM
VWC 3966 4022 1.26e0 SMART
TSP1 4009 4059 4.05e-5 SMART
TSP1 4103 4155 3.19e-12 SMART
TSP1 4161 4213 2.87e-2 SMART
TSP1 4218 4269 1.45e-6 SMART
Pfam:TIL 4273 4328 2.1e-10 PFAM
TSP1 4468 4516 7.56e-5 SMART
low complexity region 4551 4562 N/A INTRINSIC
VWC 4578 4652 5.21e-1 SMART
TSP1 4619 4669 3.92e-12 SMART
Pfam:TIL 4671 4725 1.5e-11 PFAM
Pfam:TIL 4777 4835 3.1e-9 PFAM
VWC 4837 4892 1.8e-11 SMART
GHB 4904 4997 1.02e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169350
AA Change: C4297R

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797
AA Change: C4297R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
VWD 185 341 4.36e-28 SMART
C8 390 469 2.3e-10 SMART
Pfam:TIL 472 527 8.6e-13 PFAM
VWC 529 571 2e-1 SMART
VWD 556 716 5.08e-29 SMART
C8 754 826 2.14e-28 SMART
Pfam:TIL 829 882 1.6e-10 PFAM
VWC 979 1047 4.76e-2 SMART
VWD 1006 1165 9.59e-48 SMART
C8 1201 1275 3.62e-26 SMART
Pfam:TIL 1278 1334 7e-13 PFAM
LDLa 1378 1416 2.29e-13 SMART
LDLa 1418 1453 1.87e-9 SMART
LDLa 1454 1491 5.77e-10 SMART
LDLa 1494 1533 1.52e-9 SMART
LDLa 1567 1604 2.55e-11 SMART
LDLa 1605 1645 5.6e-8 SMART
LDLa 1658 1699 2.29e-4 SMART
TSP1 1700 1751 6.47e-13 SMART
TSP1 1756 1811 1.35e-10 SMART
Pfam:TIL 1815 1871 8.3e-9 PFAM
VWC 1873 1928 2.42e-1 SMART
TSP1 1915 1968 6.94e-2 SMART
VWC 1970 2027 4.95e-9 SMART
low complexity region 2042 2052 N/A INTRINSIC
FA58C 2069 2226 1.4e-2 SMART
LDLa 2232 2269 1.48e-7 SMART
LDLa 2387 2424 5.68e-9 SMART
LDLa 2444 2481 5.77e-10 SMART
TSP1 2484 2534 1.42e-9 SMART
TSP1 2539 2591 6.36e-21 SMART
Pfam:TIL 2606 2656 1.8e-9 PFAM
VWC 2658 2712 2.48e-1 SMART
TSP1 2699 2750 3.07e-14 SMART
TSP1 2756 2809 4.05e-5 SMART
TSP1 2814 2864 1.83e-12 SMART
EGF_like 2878 2921 5.45e1 SMART
VWC 2928 2981 2.73e-11 SMART
TSP1 2968 3020 3.72e-13 SMART
TSP1 3023 3064 6.05e-4 SMART
Pfam:TIL 3071 3123 3e-11 PFAM
VWC 3125 3180 9.77e-2 SMART
TSP1 3167 3231 6.68e-6 SMART
TSP1 3236 3288 1.08e-14 SMART
Pfam:TIL 3292 3346 6e-9 PFAM
VWC 3348 3405 2.72e-1 SMART
TSP1 3392 3451 3.72e-4 SMART
TSP1 3456 3508 5.27e-4 SMART
Pfam:TIL 3510 3566 1.1e-8 PFAM
TSP1 3629 3674 1.87e-9 SMART
low complexity region 3734 3744 N/A INTRINSIC
TSP1 3803 3856 5.02e-10 SMART
TSP1 3873 3922 2.95e-7 SMART
TSP1 3939 3992 1.99e-13 SMART
TSP1 3997 4049 2.51e-10 SMART
Pfam:TIL 4052 4107 9.1e-11 PFAM
VWC 4109 4165 1.26e0 SMART
TSP1 4152 4202 4.05e-5 SMART
TSP1 4246 4298 3.19e-12 SMART
TSP1 4304 4356 2.87e-2 SMART
TSP1 4361 4412 1.45e-6 SMART
Pfam:TIL 4416 4471 5.6e-10 PFAM
TSP1 4611 4659 7.56e-5 SMART
low complexity region 4694 4705 N/A INTRINSIC
VWC 4721 4795 5.21e-1 SMART
TSP1 4762 4812 3.92e-12 SMART
Pfam:TIL 4814 4868 4e-11 PFAM
Pfam:TIL 4920 4978 8.4e-9 PFAM
VWC 4980 5035 1.8e-11 SMART
GHB 5050 5143 1.02e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185370
AA Change: C328R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139484
Gene: ENSMUSG00000029797
AA Change: C328R

DomainStartEndE-ValueType
TSP1 28 80 1.2e-12 SMART
Pfam:TIL 83 138 3.8e-9 PFAM
VWC 140 196 6e-3 SMART
TSP1 183 233 1.9e-7 SMART
TSP1 277 329 1.5e-14 SMART
TSP1 335 387 1.4e-4 SMART
TSP1 392 443 6.8e-9 SMART
Pfam:TIL 447 502 2e-8 PFAM
Blast:TSP1 549 637 2e-11 BLAST
TSP1 642 690 3.7e-7 SMART
Pfam:TIL 694 750 1.3e-7 PFAM
VWC_def 752 826 2.5e-3 SMART
TSP1 793 843 1.9e-14 SMART
Pfam:TIL 845 899 2.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188970
SMART Domains Protein: ENSMUSP00000140642
Gene: ENSMUSG00000029797

DomainStartEndE-ValueType
Pfam:TSP_1 1 40 9.4e-5 PFAM
TSP1 105 155 1.9e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189910
Predicted Effect probably damaging
Transcript: ENSMUST00000212740
AA Change: C4288R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.1967 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 95.3%
  • 10x: 69.3%
  • 20x: 30.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,891,679 (GRCm38) V261E probably damaging Het
Abca15 A G 7: 120,382,497 (GRCm38) E1058G probably benign Het
Abcb5 T G 12: 118,867,946 (GRCm38) I1224L possibly damaging Het
Actn4 A G 7: 28,905,328 (GRCm38) V348A probably benign Het
Agtr1b A T 3: 20,315,500 (GRCm38) L314H probably damaging Het
Ankrd55 T C 13: 112,367,926 (GRCm38) M402T probably benign Het
Asap2 A G 12: 21,213,179 (GRCm38) Q265R probably benign Het
Atp2b4 G A 1: 133,706,939 (GRCm38) R1124C probably damaging Het
Atp2c1 A T 9: 105,435,152 (GRCm38) C353* probably null Het
Atp8b5 T A 4: 43,291,733 (GRCm38) probably null Het
Baz1b T A 5: 135,217,979 (GRCm38) Y761N probably damaging Het
Bend6 A G 1: 33,864,743 (GRCm38) V38A probably benign Het
Camk1g T C 1: 193,362,091 (GRCm38) E5G possibly damaging Het
Ccdc14 T A 16: 34,706,782 (GRCm38) H352Q probably damaging Het
Cdh2 A G 18: 16,624,267 (GRCm38) V641A possibly damaging Het
Celsr2 C A 3: 108,414,108 (GRCm38) D463Y probably damaging Het
Cfap43 A G 19: 47,896,875 (GRCm38) Y434H probably damaging Het
Cnih2 T C 19: 5,093,702 (GRCm38) Y142C probably damaging Het
Coa5 T A 1: 37,420,600 (GRCm38) R71* probably null Het
Csmd3 A T 15: 47,669,202 (GRCm38) Y2532* probably null Het
Cytl1 A T 5: 37,735,647 (GRCm38) M34L probably benign Het
Dctn1 T A 6: 83,192,889 (GRCm38) I590N probably damaging Het
Dhx57 T C 17: 80,254,418 (GRCm38) H889R probably damaging Het
Dock10 A G 1: 80,512,558 (GRCm38) I1948T probably benign Het
Dock3 A T 9: 106,955,709 (GRCm38) N1034K probably benign Het
Dzip1l G A 9: 99,659,776 (GRCm38) probably null Het
Eif4g1 T A 16: 20,680,008 (GRCm38) V439E possibly damaging Het
Eml5 T C 12: 98,858,823 (GRCm38) I712V probably benign Het
Entrep1 G A 19: 23,973,606 (GRCm38) T537I probably benign Het
Epha3 C T 16: 63,653,494 (GRCm38) G300D probably damaging Het
Erbb4 A C 1: 68,560,682 (GRCm38) S79A probably damaging Het
Gclc T C 9: 77,781,137 (GRCm38) V205A probably benign Het
Gdpd4 A G 7: 97,974,466 (GRCm38) probably null Het
Gm11564 C T 11: 99,815,232 (GRCm38) C124Y unknown Het
Gm16494 T C 17: 47,016,844 (GRCm38) E38G probably damaging Het
Gtf2h1 T C 7: 46,805,125 (GRCm38) probably null Het
Gtsf2 G T 15: 103,441,217 (GRCm38) R68S probably benign Het
Heatr5b T C 17: 78,808,384 (GRCm38) Q881R probably damaging Het
Hmox1 C A 8: 75,098,835 (GRCm38) L236I probably benign Het
Ighv8-12 T C 12: 115,648,343 (GRCm38) I7V probably benign Het
Izumo1 T C 7: 45,623,013 (GRCm38) S73P probably damaging Het
Kifbp A T 10: 62,559,450 (GRCm38) F471Y probably damaging Het
Knl1 A G 2: 119,071,346 (GRCm38) N1176S possibly damaging Het
Mecom A T 3: 29,980,048 (GRCm38) L493Q probably damaging Het
Mprip T C 11: 59,759,190 (GRCm38) V1240A probably damaging Het
Mrpl3 T C 9: 105,077,002 (GRCm38) S302P probably damaging Het
Mycbp2 T C 14: 103,188,520 (GRCm38) T2390A probably damaging Het
Myo1c T C 11: 75,669,961 (GRCm38) S766P probably damaging Het
Myo9b A G 8: 71,291,036 (GRCm38) Q247R probably damaging Het
Nav3 G A 10: 109,760,508 (GRCm38) T1423I probably damaging Het
Nefh A T 11: 4,940,066 (GRCm38) I851N probably benign Het
Nup98 T C 7: 102,138,801 (GRCm38) T1004A probably benign Het
Olfr175-ps1 G A 16: 58,824,610 (GRCm38) T33I probably benign Het
Or1e17 T C 11: 73,940,557 (GRCm38) F104L probably benign Het
Or1e22 G A 11: 73,486,323 (GRCm38) S167L possibly damaging Het
Or5p76 T C 7: 108,523,204 (GRCm38) T249A probably benign Het
Osgin1 G T 8: 119,445,385 (GRCm38) R306L possibly damaging Het
Otof A G 5: 30,380,227 (GRCm38) L1246P probably benign Het
Pde8a T A 7: 81,302,271 (GRCm38) N273K probably damaging Het
Phf14 T A 6: 11,933,727 (GRCm38) M196K possibly damaging Het
Pkd1l3 T C 8: 109,646,953 (GRCm38) S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,536,886 (GRCm38) V2142A probably benign Het
Plb1 A G 5: 32,354,826 (GRCm38) E1318G possibly damaging Het
Plekhh2 A G 17: 84,575,771 (GRCm38) I756V probably benign Het
Primpol A G 8: 46,593,637 (GRCm38) V208A probably benign Het
Ptch2 C A 4: 117,108,465 (GRCm38) A389E probably benign Het
Pzp A G 6: 128,512,356 (GRCm38) Y431H probably benign Het
Rnf43 G A 11: 87,731,407 (GRCm38) G445R probably damaging Het
Scn5a A T 9: 119,533,661 (GRCm38) probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 (GRCm38) probably benign Het
Shisa9 T A 16: 11,985,071 (GRCm38) M164K probably damaging Het
Skint1 A G 4: 112,025,511 (GRCm38) I251V probably benign Het
Slc16a14 C T 1: 84,929,461 (GRCm38) D31N probably damaging Het
Slc22a13 T C 9: 119,193,295 (GRCm38) S548G possibly damaging Het
Slc4a9 T C 18: 36,531,101 (GRCm38) F316L probably benign Het
Smchd1 C T 17: 71,349,730 (GRCm38) R1914H probably damaging Het
Snx16 C T 3: 10,434,371 (GRCm38) D200N probably damaging Het
Spock3 A G 8: 62,951,900 (GRCm38) D34G probably damaging Het
Sytl3 C T 17: 6,687,324 (GRCm38) A131V probably benign Het
Tacc1 T A 8: 25,182,255 (GRCm38) D319V probably benign Het
Tead1 A T 7: 112,876,184 (GRCm38) K234I probably damaging Het
Tgfbrap1 C T 1: 43,075,458 (GRCm38) V161I probably benign Het
Tnfaip3 A G 10: 19,008,269 (GRCm38) V121A probably damaging Het
Tnnt2 A G 1: 135,852,055 (GRCm38) T297A possibly damaging Het
Trappc11 G A 8: 47,503,965 (GRCm38) L809F probably damaging Het
Ttn T C 2: 76,771,525 (GRCm38) I18598V probably benign Het
Ugt1a10 G A 1: 88,216,254 (GRCm38) A199T probably damaging Het
Unc5a A G 13: 54,996,419 (GRCm38) N186D probably damaging Het
Uqcrfs1 C A 13: 30,540,801 (GRCm38) G252V probably damaging Het
Vmn2r115 T C 17: 23,346,018 (GRCm38) I293T probably damaging Het
Vmn2r9 T C 5: 108,843,828 (GRCm38) T556A probably benign Het
Ythdc2 T A 18: 44,864,462 (GRCm38) Y1029N probably benign Het
Zfp451 T A 1: 33,769,813 (GRCm38) K989M possibly damaging Het
Zfpm1 C T 8: 122,335,846 (GRCm38) T548M probably damaging Het
Other mutations in Sspo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Sspo APN 6 48,470,453 (GRCm38) missense probably benign 0.02
IGL00339:Sspo APN 6 48,483,746 (GRCm38) splice site probably benign
IGL00391:Sspo APN 6 48,497,386 (GRCm38) missense probably damaging 0.96
IGL00433:Sspo APN 6 48,490,036 (GRCm38) missense probably damaging 1.00
IGL00471:Sspo APN 6 48,498,213 (GRCm38) splice site probably benign
IGL00500:Sspo APN 6 48,497,421 (GRCm38) nonsense probably null
IGL00537:Sspo APN 6 48,498,213 (GRCm38) splice site probably benign
IGL00540:Sspo APN 6 48,498,213 (GRCm38) splice site probably benign
IGL01060:Sspo APN 6 48,449,479 (GRCm38) nonsense probably null
IGL01090:Sspo APN 6 48,490,125 (GRCm38) missense probably benign 0.08
IGL01125:Sspo APN 6 48,492,888 (GRCm38) missense probably damaging 1.00
IGL01447:Sspo APN 6 48,464,666 (GRCm38) splice site probably null
IGL01457:Sspo APN 6 48,498,343 (GRCm38) missense probably benign 0.00
IGL01481:Sspo APN 6 48,448,515 (GRCm38) missense probably benign 0.41
IGL01485:Sspo APN 6 48,478,731 (GRCm38) missense probably damaging 1.00
IGL01544:Sspo APN 6 48,491,019 (GRCm38) missense probably damaging 0.99
IGL01575:Sspo APN 6 48,459,042 (GRCm38) missense probably benign 0.01
IGL01589:Sspo APN 6 48,451,178 (GRCm38) missense probably damaging 1.00
IGL01601:Sspo APN 6 48,486,379 (GRCm38) missense probably benign 0.33
IGL01644:Sspo APN 6 48,452,502 (GRCm38) missense probably benign
IGL01659:Sspo APN 6 48,474,443 (GRCm38) missense probably damaging 1.00
IGL01801:Sspo APN 6 48,457,138 (GRCm38) missense probably damaging 1.00
IGL01872:Sspo APN 6 48,454,689 (GRCm38) missense probably damaging 0.99
IGL01874:Sspo APN 6 48,452,190 (GRCm38) missense probably damaging 1.00
IGL01936:Sspo APN 6 48,475,887 (GRCm38) missense probably damaging 1.00
IGL01941:Sspo APN 6 48,495,182 (GRCm38) missense probably benign 0.19
IGL01986:Sspo APN 6 48,483,303 (GRCm38) missense probably benign 0.05
IGL01987:Sspo APN 6 48,477,624 (GRCm38) splice site probably null
IGL02170:Sspo APN 6 48,467,983 (GRCm38) missense possibly damaging 0.76
IGL02192:Sspo APN 6 48,459,568 (GRCm38) missense possibly damaging 0.86
IGL02210:Sspo APN 6 48,500,492 (GRCm38) missense probably damaging 1.00
IGL02225:Sspo APN 6 48,484,334 (GRCm38) missense probably benign 0.09
IGL02280:Sspo APN 6 48,496,231 (GRCm38) missense probably damaging 1.00
IGL02303:Sspo APN 6 48,484,705 (GRCm38) missense possibly damaging 0.52
IGL02397:Sspo APN 6 48,461,638 (GRCm38) missense probably benign 0.35
IGL02451:Sspo APN 6 48,460,303 (GRCm38) splice site probably benign
IGL02500:Sspo APN 6 48,478,379 (GRCm38) nonsense probably null
IGL02519:Sspo APN 6 48,484,828 (GRCm38) missense probably damaging 1.00
IGL02549:Sspo APN 6 48,451,773 (GRCm38) missense possibly damaging 0.81
IGL02562:Sspo APN 6 48,490,122 (GRCm38) splice site probably null
IGL02673:Sspo APN 6 48,498,775 (GRCm38) critical splice donor site probably null
IGL02673:Sspo APN 6 48,475,860 (GRCm38) missense probably damaging 1.00
IGL02719:Sspo APN 6 48,482,667 (GRCm38) missense probably benign 0.39
IGL02793:Sspo APN 6 48,487,894 (GRCm38) splice site probably benign
IGL03003:Sspo APN 6 48,455,087 (GRCm38) missense probably damaging 0.98
IGL03056:Sspo APN 6 48,470,538 (GRCm38) missense probably benign 0.17
IGL03105:Sspo APN 6 48,473,658 (GRCm38) splice site probably benign
IGL03116:Sspo APN 6 48,494,101 (GRCm38) missense probably benign 0.32
IGL03163:Sspo APN 6 48,484,332 (GRCm38) missense probably benign 0.19
IGL03198:Sspo APN 6 48,477,582 (GRCm38) missense probably benign 0.31
IGL03365:Sspo APN 6 48,459,415 (GRCm38) missense possibly damaging 0.82
Barrier UTSW 6 48,495,212 (GRCm38) missense possibly damaging 0.58
R0312_sspo_280 UTSW 6 48,455,401 (GRCm38) missense possibly damaging 0.52
R3112_Sspo_731 UTSW 6 48,457,600 (GRCm38) missense probably damaging 1.00
R3498_Sspo_650 UTSW 6 48,467,980 (GRCm38) missense possibly damaging 0.58
R4180_Sspo_324 UTSW 6 48,498,395 (GRCm38) critical splice donor site probably null
spotsylvania UTSW 6 48,476,571 (GRCm38) nonsense probably null
ANU74:Sspo UTSW 6 48,460,959 (GRCm38) missense probably damaging 1.00
IGL02984:Sspo UTSW 6 48,495,155 (GRCm38) missense probably benign 0.33
IGL03052:Sspo UTSW 6 48,460,453 (GRCm38) missense probably damaging 1.00
IGL03134:Sspo UTSW 6 48,451,065 (GRCm38) missense probably benign 0.28
PIT4531001:Sspo UTSW 6 48,481,239 (GRCm38) missense probably benign
R0087:Sspo UTSW 6 48,477,785 (GRCm38) missense probably damaging 1.00
R0122:Sspo UTSW 6 48,473,976 (GRCm38) missense possibly damaging 0.95
R0129:Sspo UTSW 6 48,455,418 (GRCm38) missense probably benign 0.00
R0164:Sspo UTSW 6 48,494,194 (GRCm38) splice site probably benign
R0195:Sspo UTSW 6 48,486,636 (GRCm38) missense probably benign
R0200:Sspo UTSW 6 48,486,415 (GRCm38) missense probably null 0.01
R0201:Sspo UTSW 6 48,455,752 (GRCm38) missense possibly damaging 0.64
R0241:Sspo UTSW 6 48,461,495 (GRCm38) missense possibly damaging 0.82
R0241:Sspo UTSW 6 48,461,495 (GRCm38) missense possibly damaging 0.82
R0243:Sspo UTSW 6 48,493,186 (GRCm38) missense probably damaging 1.00
R0268:Sspo UTSW 6 48,465,555 (GRCm38) missense probably benign 0.26
R0312:Sspo UTSW 6 48,455,401 (GRCm38) missense possibly damaging 0.52
R0449:Sspo UTSW 6 48,466,740 (GRCm38) missense probably damaging 1.00
R0523:Sspo UTSW 6 48,451,860 (GRCm38) missense probably benign 0.20
R0576:Sspo UTSW 6 48,464,942 (GRCm38) splice site probably null
R0671:Sspo UTSW 6 48,490,391 (GRCm38) splice site probably benign
R0828:Sspo UTSW 6 48,498,734 (GRCm38) missense probably damaging 1.00
R0880:Sspo UTSW 6 48,475,935 (GRCm38) missense possibly damaging 0.69
R0903:Sspo UTSW 6 48,455,308 (GRCm38) critical splice acceptor site probably null
R1051:Sspo UTSW 6 48,491,455 (GRCm38) nonsense probably null
R1083:Sspo UTSW 6 48,470,999 (GRCm38) missense possibly damaging 0.91
R1109:Sspo UTSW 6 48,497,443 (GRCm38) missense probably damaging 1.00
R1118:Sspo UTSW 6 48,459,418 (GRCm38) missense probably damaging 0.97
R1256:Sspo UTSW 6 48,457,639 (GRCm38) missense probably damaging 1.00
R1342:Sspo UTSW 6 48,461,635 (GRCm38) missense probably benign 0.07
R1355:Sspo UTSW 6 48,448,626 (GRCm38) missense probably benign 0.41
R1370:Sspo UTSW 6 48,448,626 (GRCm38) missense probably benign 0.41
R1469:Sspo UTSW 6 48,490,982 (GRCm38) missense probably damaging 1.00
R1476:Sspo UTSW 6 48,463,400 (GRCm38) critical splice donor site probably null
R1566:Sspo UTSW 6 48,466,870 (GRCm38) critical splice donor site probably null
R1630:Sspo UTSW 6 48,457,724 (GRCm38) missense probably benign 0.01
R1686:Sspo UTSW 6 48,460,400 (GRCm38) missense probably benign 0.00
R1707:Sspo UTSW 6 48,477,877 (GRCm38) missense probably damaging 0.99
R1727:Sspo UTSW 6 48,494,848 (GRCm38) missense probably damaging 1.00
R1822:Sspo UTSW 6 48,492,886 (GRCm38) missense possibly damaging 0.75
R1831:Sspo UTSW 6 48,489,786 (GRCm38) missense probably damaging 1.00
R1835:Sspo UTSW 6 48,457,340 (GRCm38) missense probably damaging 0.97
R1862:Sspo UTSW 6 48,491,006 (GRCm38) missense probably damaging 0.98
R1878:Sspo UTSW 6 48,459,366 (GRCm38) missense possibly damaging 0.92
R1900:Sspo UTSW 6 48,459,350 (GRCm38) missense probably benign 0.22
R1945:Sspo UTSW 6 48,489,773 (GRCm38) missense possibly damaging 0.93
R1957:Sspo UTSW 6 48,478,273 (GRCm38) missense probably damaging 0.99
R1990:Sspo UTSW 6 48,451,050 (GRCm38) missense probably benign 0.00
R1996:Sspo UTSW 6 48,475,490 (GRCm38) missense possibly damaging 0.50
R2049:Sspo UTSW 6 48,463,531 (GRCm38) missense probably benign 0.36
R2049:Sspo UTSW 6 48,460,763 (GRCm38) splice site probably benign
R2064:Sspo UTSW 6 48,473,662 (GRCm38) missense probably damaging 0.99
R2072:Sspo UTSW 6 48,473,517 (GRCm38) missense probably benign 0.01
R2096:Sspo UTSW 6 48,461,674 (GRCm38) missense probably benign
R2106:Sspo UTSW 6 48,466,316 (GRCm38) missense possibly damaging 0.96
R2230:Sspo UTSW 6 48,500,503 (GRCm38) missense probably benign 0.11
R2230:Sspo UTSW 6 48,448,672 (GRCm38) missense probably damaging 0.97
R2232:Sspo UTSW 6 48,448,672 (GRCm38) missense probably damaging 0.97
R2351:Sspo UTSW 6 48,464,869 (GRCm38) missense probably damaging 1.00
R2423:Sspo UTSW 6 48,454,055 (GRCm38) missense probably benign 0.00
R2508:Sspo UTSW 6 48,464,364 (GRCm38) missense probably damaging 1.00
R3110:Sspo UTSW 6 48,457,600 (GRCm38) missense probably damaging 1.00
R3112:Sspo UTSW 6 48,457,600 (GRCm38) missense probably damaging 1.00
R3413:Sspo UTSW 6 48,480,697 (GRCm38) missense probably damaging 1.00
R3433:Sspo UTSW 6 48,475,951 (GRCm38) splice site probably null
R3498:Sspo UTSW 6 48,467,980 (GRCm38) missense possibly damaging 0.58
R3732:Sspo UTSW 6 48,449,930 (GRCm38) missense probably damaging 1.00
R3816:Sspo UTSW 6 48,481,103 (GRCm38) missense possibly damaging 0.77
R3818:Sspo UTSW 6 48,481,103 (GRCm38) missense possibly damaging 0.77
R3819:Sspo UTSW 6 48,481,103 (GRCm38) missense possibly damaging 0.77
R3838:Sspo UTSW 6 48,480,820 (GRCm38) missense probably damaging 1.00
R3850:Sspo UTSW 6 48,492,490 (GRCm38) missense probably damaging 1.00
R3880:Sspo UTSW 6 48,494,940 (GRCm38) missense probably benign 0.38
R3893:Sspo UTSW 6 48,476,571 (GRCm38) nonsense probably null
R4116:Sspo UTSW 6 48,456,994 (GRCm38) missense probably damaging 0.99
R4179:Sspo UTSW 6 48,498,395 (GRCm38) critical splice donor site probably null
R4180:Sspo UTSW 6 48,498,395 (GRCm38) critical splice donor site probably null
R4207:Sspo UTSW 6 48,478,293 (GRCm38) missense probably benign 0.00
R4210:Sspo UTSW 6 48,464,901 (GRCm38) missense probably benign 0.00
R4223:Sspo UTSW 6 48,451,157 (GRCm38) missense possibly damaging 0.54
R4224:Sspo UTSW 6 48,451,157 (GRCm38) missense possibly damaging 0.54
R4225:Sspo UTSW 6 48,451,157 (GRCm38) missense possibly damaging 0.54
R4229:Sspo UTSW 6 48,490,934 (GRCm38) missense probably benign 0.00
R4230:Sspo UTSW 6 48,490,934 (GRCm38) missense probably benign 0.00
R4363:Sspo UTSW 6 48,498,731 (GRCm38) missense probably damaging 1.00
R4370:Sspo UTSW 6 48,466,348 (GRCm38) missense probably null 0.14
R4407:Sspo UTSW 6 48,460,520 (GRCm38) missense probably damaging 1.00
R4438:Sspo UTSW 6 48,487,353 (GRCm38) missense probably damaging 1.00
R4454:Sspo UTSW 6 48,487,225 (GRCm38) missense probably benign 0.05
R4455:Sspo UTSW 6 48,465,516 (GRCm38) missense probably damaging 1.00
R4561:Sspo UTSW 6 48,475,534 (GRCm38) splice site probably null
R4574:Sspo UTSW 6 48,465,523 (GRCm38) missense probably damaging 1.00
R4578:Sspo UTSW 6 48,463,373 (GRCm38) missense possibly damaging 0.58
R4653:Sspo UTSW 6 48,478,646 (GRCm38) missense probably damaging 1.00
R4656:Sspo UTSW 6 48,454,076 (GRCm38) missense possibly damaging 0.65
R4659:Sspo UTSW 6 48,484,213 (GRCm38) missense probably damaging 1.00
R4664:Sspo UTSW 6 48,473,534 (GRCm38) missense possibly damaging 0.82
R4685:Sspo UTSW 6 48,492,894 (GRCm38) missense probably damaging 0.98
R4692:Sspo UTSW 6 48,482,687 (GRCm38) missense probably damaging 1.00
R4703:Sspo UTSW 6 48,500,453 (GRCm38) missense probably damaging 1.00
R4704:Sspo UTSW 6 48,498,704 (GRCm38) missense probably damaging 1.00
R4738:Sspo UTSW 6 48,478,396 (GRCm38) missense possibly damaging 0.78
R4766:Sspo UTSW 6 48,470,580 (GRCm38) missense probably benign 0.04
R4771:Sspo UTSW 6 48,460,879 (GRCm38) missense probably damaging 1.00
R4790:Sspo UTSW 6 48,460,771 (GRCm38) missense probably benign 0.04
R4792:Sspo UTSW 6 48,461,585 (GRCm38) missense probably benign 0.00
R4808:Sspo UTSW 6 48,451,161 (GRCm38) missense probably damaging 1.00
R4812:Sspo UTSW 6 48,490,510 (GRCm38) missense probably benign 0.00
R4883:Sspo UTSW 6 48,460,822 (GRCm38) missense probably benign 0.00
R4906:Sspo UTSW 6 48,465,730 (GRCm38) critical splice acceptor site probably null
R4934:Sspo UTSW 6 48,465,552 (GRCm38) missense probably damaging 1.00
R4945:Sspo UTSW 6 48,467,087 (GRCm38) splice site probably null
R4967:Sspo UTSW 6 48,464,605 (GRCm38) missense probably damaging 0.97
R5016:Sspo UTSW 6 48,452,280 (GRCm38) nonsense probably null
R5018:Sspo UTSW 6 48,455,700 (GRCm38) missense probably damaging 1.00
R5034:Sspo UTSW 6 48,480,823 (GRCm38) missense possibly damaging 0.93
R5044:Sspo UTSW 6 48,466,955 (GRCm38) critical splice acceptor site probably null
R5055:Sspo UTSW 6 48,464,795 (GRCm38) missense probably damaging 1.00
R5087:Sspo UTSW 6 48,488,471 (GRCm38) missense possibly damaging 0.51
R5155:Sspo UTSW 6 48,460,474 (GRCm38) missense probably benign 0.03
R5223:Sspo UTSW 6 48,478,324 (GRCm38) missense probably damaging 1.00
R5249:Sspo UTSW 6 48,493,310 (GRCm38) missense probably damaging 0.98
R5257:Sspo UTSW 6 48,476,494 (GRCm38) missense probably damaging 1.00
R5258:Sspo UTSW 6 48,476,494 (GRCm38) missense probably damaging 1.00
R5276:Sspo UTSW 6 48,490,467 (GRCm38) missense probably damaging 1.00
R5307:Sspo UTSW 6 48,454,850 (GRCm38) missense probably damaging 0.99
R5341:Sspo UTSW 6 48,459,615 (GRCm38) missense probably damaging 1.00
R5361:Sspo UTSW 6 48,466,313 (GRCm38) missense probably benign 0.02
R5385:Sspo UTSW 6 48,462,253 (GRCm38) missense probably benign 0.18
R5394:Sspo UTSW 6 48,495,260 (GRCm38) missense possibly damaging 0.52
R5477:Sspo UTSW 6 48,498,393 (GRCm38) missense possibly damaging 0.60
R5490:Sspo UTSW 6 48,493,280 (GRCm38) missense probably benign 0.33
R5512:Sspo UTSW 6 48,455,671 (GRCm38) missense probably damaging 0.97
R5518:Sspo UTSW 6 48,496,654 (GRCm38) missense possibly damaging 0.92
R5530:Sspo UTSW 6 48,465,583 (GRCm38) missense probably damaging 0.97
R5538:Sspo UTSW 6 48,452,178 (GRCm38) missense probably damaging 0.99
R5590:Sspo UTSW 6 48,474,491 (GRCm38) missense probably damaging 1.00
R5613:Sspo UTSW 6 48,455,044 (GRCm38) missense possibly damaging 0.79
R5638:Sspo UTSW 6 48,492,891 (GRCm38) missense possibly damaging 0.86
R5809:Sspo UTSW 6 48,460,045 (GRCm38) missense possibly damaging 0.59
R5810:Sspo UTSW 6 48,483,898 (GRCm38) missense probably benign 0.02
R5814:Sspo UTSW 6 48,451,884 (GRCm38) missense probably damaging 1.00
R5915:Sspo UTSW 6 48,491,484 (GRCm38) missense possibly damaging 0.83
R5915:Sspo UTSW 6 48,464,596 (GRCm38) missense probably benign 0.00
R5979:Sspo UTSW 6 48,463,693 (GRCm38) missense probably benign 0.20
R5996:Sspo UTSW 6 48,494,176 (GRCm38) missense possibly damaging 0.87
R6012:Sspo UTSW 6 48,451,371 (GRCm38) missense probably benign 0.00
R6025:Sspo UTSW 6 48,486,786 (GRCm38) missense possibly damaging 0.83
R6120:Sspo UTSW 6 48,465,576 (GRCm38) missense probably damaging 1.00
R6150:Sspo UTSW 6 48,486,379 (GRCm38) missense probably benign 0.33
R6221:Sspo UTSW 6 48,463,705 (GRCm38) missense probably damaging 1.00
R6261:Sspo UTSW 6 48,462,191 (GRCm38) missense possibly damaging 0.75
R6312:Sspo UTSW 6 48,457,366 (GRCm38) critical splice donor site probably null
R6372:Sspo UTSW 6 48,472,541 (GRCm38) missense probably damaging 1.00
R6456:Sspo UTSW 6 48,451,806 (GRCm38) missense probably benign 0.08
R6497:Sspo UTSW 6 48,495,208 (GRCm38) missense possibly damaging 0.71
R6501:Sspo UTSW 6 48,495,212 (GRCm38) missense possibly damaging 0.58
R6617:Sspo UTSW 6 48,491,046 (GRCm38) missense possibly damaging 0.93
R6825:Sspo UTSW 6 48,465,525 (GRCm38) missense probably benign 0.04
R6831:Sspo UTSW 6 48,484,833 (GRCm38) missense possibly damaging 0.68
R6861:Sspo UTSW 6 48,487,955 (GRCm38) missense probably benign 0.15
R6961:Sspo UTSW 6 48,463,877 (GRCm38) missense probably benign 0.05
R6967:Sspo UTSW 6 48,489,794 (GRCm38) missense probably benign 0.21
R7016:Sspo UTSW 6 48,449,164 (GRCm38) missense probably damaging 1.00
R7035:Sspo UTSW 6 48,449,213 (GRCm38) splice site probably null
R7058:Sspo UTSW 6 48,448,582 (GRCm38) missense probably damaging 1.00
R7072:Sspo UTSW 6 48,454,979 (GRCm38) missense probably damaging 1.00
R7078:Sspo UTSW 6 48,460,379 (GRCm38) missense probably damaging 1.00
R7082:Sspo UTSW 6 48,478,609 (GRCm38) critical splice acceptor site probably null
R7120:Sspo UTSW 6 48,465,571 (GRCm38) missense probably benign 0.05
R7127:Sspo UTSW 6 48,449,512 (GRCm38) missense probably benign 0.02
R7146:Sspo UTSW 6 48,501,095 (GRCm38) missense probably benign 0.15
R7220:Sspo UTSW 6 48,476,606 (GRCm38) nonsense probably null
R7242:Sspo UTSW 6 48,473,952 (GRCm38) missense probably benign
R7261:Sspo UTSW 6 48,450,077 (GRCm38) missense possibly damaging 0.52
R7313:Sspo UTSW 6 48,473,456 (GRCm38) missense probably benign 0.04
R7313:Sspo UTSW 6 48,454,828 (GRCm38) missense probably damaging 1.00
R7323:Sspo UTSW 6 48,461,647 (GRCm38) missense possibly damaging 0.93
R7330:Sspo UTSW 6 48,475,462 (GRCm38) missense probably benign 0.00
R7351:Sspo UTSW 6 48,464,921 (GRCm38) missense possibly damaging 0.89
R7467:Sspo UTSW 6 48,486,303 (GRCm38) missense probably damaging 1.00
R7475:Sspo UTSW 6 48,455,860 (GRCm38) missense probably benign 0.37
R7489:Sspo UTSW 6 48,473,713 (GRCm38) missense probably damaging 0.99
R7508:Sspo UTSW 6 48,466,699 (GRCm38) missense probably damaging 1.00
R7515:Sspo UTSW 6 48,493,886 (GRCm38) missense probably damaging 1.00
R7564:Sspo UTSW 6 48,449,500 (GRCm38) missense probably benign 0.04
R7607:Sspo UTSW 6 48,489,727 (GRCm38) missense probably damaging 1.00
R7620:Sspo UTSW 6 48,467,086 (GRCm38) critical splice donor site probably null
R7667:Sspo UTSW 6 48,475,371 (GRCm38) nonsense probably null
R7691:Sspo UTSW 6 48,484,229 (GRCm38) missense probably benign 0.12
R7707:Sspo UTSW 6 48,461,527 (GRCm38) missense probably benign 0.01
R7723:Sspo UTSW 6 48,464,638 (GRCm38) missense probably damaging 0.99
R7748:Sspo UTSW 6 48,449,465 (GRCm38) nonsense probably null
R7767:Sspo UTSW 6 48,451,382 (GRCm38) missense probably damaging 0.96
R7792:Sspo UTSW 6 48,454,690 (GRCm38) missense probably damaging 0.98
R7878:Sspo UTSW 6 48,492,526 (GRCm38) missense probably damaging 1.00
R7893:Sspo UTSW 6 48,463,310 (GRCm38) missense probably benign 0.02
R7942:Sspo UTSW 6 48,488,500 (GRCm38) splice site probably null
R7952:Sspo UTSW 6 48,487,329 (GRCm38) missense probably damaging 1.00
R7981:Sspo UTSW 6 48,468,494 (GRCm38) missense probably benign
R7995:Sspo UTSW 6 48,492,889 (GRCm38) missense probably damaging 1.00
R8088:Sspo UTSW 6 48,457,613 (GRCm38) missense probably damaging 1.00
R8129:Sspo UTSW 6 48,467,025 (GRCm38) missense possibly damaging 0.79
R8145:Sspo UTSW 6 48,467,749 (GRCm38) missense possibly damaging 0.49
R8202:Sspo UTSW 6 48,457,600 (GRCm38) missense probably damaging 1.00
R8211:Sspo UTSW 6 48,492,609 (GRCm38) critical splice donor site probably null
R8240:Sspo UTSW 6 48,483,502 (GRCm38) missense possibly damaging 0.84
R8252:Sspo UTSW 6 48,485,452 (GRCm38) missense probably damaging 0.99
R8270:Sspo UTSW 6 48,449,963 (GRCm38) missense probably benign
R8272:Sspo UTSW 6 48,448,519 (GRCm38) missense probably benign 0.03
R8316:Sspo UTSW 6 48,482,688 (GRCm38) missense probably damaging 1.00
R8384:Sspo UTSW 6 48,482,664 (GRCm38) missense probably damaging 1.00
R8390:Sspo UTSW 6 48,467,962 (GRCm38) missense probably benign 0.00
R8770:Sspo UTSW 6 48,474,272 (GRCm38) missense probably null 1.00
R8827:Sspo UTSW 6 48,457,672 (GRCm38) missense possibly damaging 0.59
R8882:Sspo UTSW 6 48,475,456 (GRCm38) missense probably damaging 1.00
R8886:Sspo UTSW 6 48,481,267 (GRCm38) missense possibly damaging 0.92
R8946:Sspo UTSW 6 48,457,137 (GRCm38) missense probably damaging 1.00
R8947:Sspo UTSW 6 48,448,570 (GRCm38) missense probably damaging 1.00
R9028:Sspo UTSW 6 48,496,153 (GRCm38) missense probably benign 0.38
R9043:Sspo UTSW 6 48,493,280 (GRCm38) missense probably benign 0.07
R9056:Sspo UTSW 6 48,473,674 (GRCm38) missense probably damaging 0.97
R9071:Sspo UTSW 6 48,457,048 (GRCm38) missense probably benign 0.00
R9133:Sspo UTSW 6 48,457,813 (GRCm38) missense possibly damaging 0.81
R9187:Sspo UTSW 6 48,495,289 (GRCm38) missense probably damaging 1.00
R9205:Sspo UTSW 6 48,455,872 (GRCm38) missense probably benign 0.03
R9213:Sspo UTSW 6 48,463,935 (GRCm38) missense possibly damaging 0.91
R9214:Sspo UTSW 6 48,463,935 (GRCm38) missense possibly damaging 0.91
R9215:Sspo UTSW 6 48,463,935 (GRCm38) missense possibly damaging 0.91
R9235:Sspo UTSW 6 48,489,784 (GRCm38) missense probably damaging 1.00
R9254:Sspo UTSW 6 48,487,994 (GRCm38) missense probably damaging 1.00
R9291:Sspo UTSW 6 48,496,396 (GRCm38) missense probably damaging 1.00
R9312:Sspo UTSW 6 48,468,462 (GRCm38) missense probably benign 0.00
R9357:Sspo UTSW 6 48,467,055 (GRCm38) missense possibly damaging 0.77
R9480:Sspo UTSW 6 48,493,886 (GRCm38) missense probably damaging 1.00
R9586:Sspo UTSW 6 48,481,105 (GRCm38) missense probably benign 0.03
R9660:Sspo UTSW 6 48,455,773 (GRCm38) missense probably damaging 1.00
R9661:Sspo UTSW 6 48,478,338 (GRCm38) nonsense probably null
R9728:Sspo UTSW 6 48,455,773 (GRCm38) missense probably damaging 1.00
R9776:Sspo UTSW 6 48,462,335 (GRCm38) missense probably benign 0.00
RF009:Sspo UTSW 6 48,459,985 (GRCm38) nonsense probably null
X0060:Sspo UTSW 6 48,480,794 (GRCm38) missense probably damaging 1.00
X0060:Sspo UTSW 6 48,466,294 (GRCm38) missense probably damaging 1.00
X0063:Sspo UTSW 6 48,497,422 (GRCm38) missense probably damaging 0.96
X0065:Sspo UTSW 6 48,461,684 (GRCm38) missense probably benign 0.00
Z1176:Sspo UTSW 6 48,481,293 (GRCm38) missense probably damaging 1.00
Z1177:Sspo UTSW 6 48,490,890 (GRCm38) missense probably damaging 1.00
Z1177:Sspo UTSW 6 48,490,548 (GRCm38) nonsense probably null
Z1177:Sspo UTSW 6 48,473,435 (GRCm38) missense probably damaging 0.99
Z1177:Sspo UTSW 6 48,470,984 (GRCm38) missense probably benign 0.16
Z1177:Sspo UTSW 6 48,464,816 (GRCm38) missense possibly damaging 0.72
Z1177:Sspo UTSW 6 48,457,026 (GRCm38) missense probably benign 0.31
Z1186:Sspo UTSW 6 48,468,507 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACAGTGCCCAGAGGCTGGAC -3'
(R):5'- TGCTGCACCAGGACCTTACAGGAG -3'

Sequencing Primer
(F):5'- CCAGAGGCTGGACATTGTG -3'
(R):5'- TTACAGGAGCAGCGTGTC -3'
Posted On 2017-12-01