Incidental Mutation 'R0543:Olfr1141'
ID50030
Institutional Source Beutler Lab
Gene Symbol Olfr1141
Ensembl Gene ENSMUSG00000075148
Gene Nameolfactory receptor 1141
SynonymsMOR177-10, GA_x6K02T2Q125-49257818-49256883
MMRRC Submission 038735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0543 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87753056-87753991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87753650 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 114 (L114F)
Ref Sequence ENSEMBL: ENSMUSP00000097433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099846]
Predicted Effect probably damaging
Transcript: ENSMUST00000099846
AA Change: L114F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097433
Gene: ENSMUSG00000075148
AA Change: L114F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.8e-28 PFAM
Pfam:7tm_1 41 290 1.5e-6 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Col28a1 T A 6: 8,075,326 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Git2 G T 5: 114,745,531 H42Q probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hars2 G A 18: 36,789,424 E337K probably damaging Het
Hells A G 19: 38,967,750 R797G probably benign Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mtch2 T C 2: 90,849,682 V86A possibly damaging Het
Mttp A T 3: 138,111,696 I446N possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nostrin T G 2: 69,189,131 *507E probably null Het
Nup205 T C 6: 35,198,969 V589A probably benign Het
Olfr1444 G T 19: 12,861,888 V38F probably benign Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pdzd3 A C 9: 44,248,934 H324Q probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Strip1 G A 3: 107,626,775 T181M possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Olfr1141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr1141 APN 2 87753934 missense probably benign 0.00
IGL01412:Olfr1141 APN 2 87753117 missense probably damaging 1.00
IGL01533:Olfr1141 APN 2 87753068 missense probably benign 0.01
IGL02455:Olfr1141 APN 2 87753583 missense possibly damaging 0.95
IGL02698:Olfr1141 APN 2 87753844 nonsense probably null
PIT4480001:Olfr1141 UTSW 2 87753783 missense possibly damaging 0.95
R1542:Olfr1141 UTSW 2 87753318 missense probably damaging 0.99
R1750:Olfr1141 UTSW 2 87753186 missense probably damaging 0.97
R1844:Olfr1141 UTSW 2 87753990 start codon destroyed probably null 1.00
R2248:Olfr1141 UTSW 2 87753943 missense probably null 0.05
R4064:Olfr1141 UTSW 2 87753789 missense probably damaging 1.00
R5193:Olfr1141 UTSW 2 87753104 missense possibly damaging 0.59
R5861:Olfr1141 UTSW 2 87753578 missense probably benign 0.01
R6146:Olfr1141 UTSW 2 87753258 missense probably damaging 1.00
R6197:Olfr1141 UTSW 2 87753352 missense probably benign 0.15
R6481:Olfr1141 UTSW 2 87753468 missense probably damaging 1.00
R6857:Olfr1141 UTSW 2 87753487 missense probably damaging 1.00
R6904:Olfr1141 UTSW 2 87753879 missense probably benign 0.00
R6962:Olfr1141 UTSW 2 87753727 missense probably benign
R7014:Olfr1141 UTSW 2 87753871 missense probably benign 0.00
R8229:Olfr1141 UTSW 2 87753064 missense probably benign 0.00
T0722:Olfr1141 UTSW 2 87753123 missense probably damaging 1.00
Z1177:Olfr1141 UTSW 2 87753190 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCCTTGGCAGAATGGATTTTCAAGAC -3'
(R):5'- ACAGCTCCAAACACCAATGTACTTCTTT -3'

Sequencing Primer
(F):5'- GACAAGGACTTCTGAAATAGTGCTC -3'
(R):5'- CAAACACCAATGTACTTCTTTCTCAG -3'
Posted On2013-06-12