Incidental Mutation 'R0543:Mtch2'
ID50031
Institutional Source Beutler Lab
Gene Symbol Mtch2
Ensembl Gene ENSMUSG00000027282
Gene Namemitochondrial carrier 2
Synonyms2310034D24Rik, HSPC032, 4930539J07Rik
MMRRC Submission 038735-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0543 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90847155-90866810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90849682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 86 (V86A)
Ref Sequence ENSEMBL: ENSMUSP00000107092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111467] [ENSMUST00000111468] [ENSMUST00000136872] [ENSMUST00000150232]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000057216
Predicted Effect possibly damaging
Transcript: ENSMUST00000111467
AA Change: V86A

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107092
Gene: ENSMUSG00000027282
AA Change: V86A

DomainStartEndE-ValueType
Pfam:Mito_carr 109 198 1.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111468
Predicted Effect probably benign
Transcript: ENSMUST00000136872
AA Change: V86A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121851
Gene: ENSMUSG00000027282
AA Change: V86A

DomainStartEndE-ValueType
Pfam:Mito_carr 118 207 3.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148936
Predicted Effect probably benign
Transcript: ENSMUST00000150232
AA Change: V86A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118566
Gene: ENSMUSG00000027282
AA Change: V86A

DomainStartEndE-ValueType
Pfam:Mito_carr 127 215 1.7e-11 PFAM
Meta Mutation Damage Score 0.2865 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a member of the SLC25 family of nuclear-encoded transporters that are localized in the inner mitochondrial membrane. Members of this superfamily are involved in many metabolic pathways and cell functions. Genome-wide association studies in human have identified single-nucleotide polymorphisms in several loci associated with obesity. This gene is one such locus, which is highly expressed in white adipose tissue and adipocytes, and thought to play a regulatory role in adipocyte differentiation and biology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA can give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mesoderm development, disorganized extraembryonic tissue, lack of amnion and chorion formation, decreased embryo size, and lethality at around E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Col28a1 T A 6: 8,075,326 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Git2 G T 5: 114,745,531 H42Q probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hars2 G A 18: 36,789,424 E337K probably damaging Het
Hells A G 19: 38,967,750 R797G probably benign Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mttp A T 3: 138,111,696 I446N possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nostrin T G 2: 69,189,131 *507E probably null Het
Nup205 T C 6: 35,198,969 V589A probably benign Het
Olfr1141 C A 2: 87,753,650 L114F probably damaging Het
Olfr1444 G T 19: 12,861,888 V38F probably benign Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pdzd3 A C 9: 44,248,934 H324Q probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Strip1 G A 3: 107,626,775 T181M possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Mtch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03390:Mtch2 APN 2 90859550 missense probably benign 0.08
R0578:Mtch2 UTSW 2 90852830 splice site probably benign
R1418:Mtch2 UTSW 2 90853015 splice site probably benign
R1996:Mtch2 UTSW 2 90847321 missense possibly damaging 0.74
R4305:Mtch2 UTSW 2 90859483 missense probably benign 0.00
R6268:Mtch2 UTSW 2 90863648 missense probably benign
R6386:Mtch2 UTSW 2 90849395 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CAAGTATGTCAGCTTCCTGGCCTC -3'
(R):5'- GAATGGCTCTGATTTCTCCTCAGAACC -3'

Sequencing Primer
(F):5'- TATCTGGAAGGGTTGACATTGAAG -3'
(R):5'- accacttgtaatttctgcactc -3'
Posted On2013-06-12