Incidental Mutation 'R1466:Muc2'
ID 500325
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R1466 (G1)
Quality Score 206
Status Not validated
Chromosome 7
Chromosomal Location 141276583-141308428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141302711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 457 (Y457C)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026590]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026590
AA Change: Y18C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: Y18C

DomainStartEndE-ValueType
C8 1 63 1.65e-11 SMART
VWC 120 188 5.48e-2 SMART
VWC 229 293 2.38e-11 SMART
Blast:VWD 299 363 4e-17 BLAST
CT 380 463 3.6e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187945
AA Change: Y457C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dnah10 T A 5: 124,840,160 (GRCm39) Y1265N probably benign Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1a A G 1: 92,982,651 (GRCm39) W718R possibly damaging Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Het
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slc7a11 G T 3: 50,335,522 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Het
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uaca C T 9: 60,761,603 (GRCm39) A205V possibly damaging Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141,693,356 (GRCm38) missense probably benign 0.35
kenny APN 7 0 () nonsense
Winnie APN 7 141,286,029 (GRCm39) missense probably damaging 1.00
IGL01303:Muc2 APN 7 141,306,132 (GRCm39) missense probably benign
IGL01482:Muc2 APN 7 141,307,797 (GRCm39) missense probably damaging 0.96
IGL01875:Muc2 APN 7 141,306,477 (GRCm39) missense probably damaging 0.99
IGL02088:Muc2 APN 7 141,305,241 (GRCm39) missense probably damaging 1.00
IGL02415:Muc2 APN 7 141,305,609 (GRCm39) nonsense probably null
IGL02548:Muc2 APN 7 141,305,594 (GRCm39) missense probably damaging 1.00
IGL02836:Muc2 APN 7 141,300,450 (GRCm39) unclassified probably benign
IGL03196:Muc2 APN 7 141,301,367 (GRCm39) missense probably damaging 0.97
Muskatenwein UTSW 7 141,307,176 (GRCm39) missense unknown
nomoco UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
Schlendrian UTSW 7 141,281,925 (GRCm39) missense probably damaging 1.00
Seco UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
BB001:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
BB011:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
E0370:Muc2 UTSW 7 141,282,598 (GRCm39) missense probably damaging 1.00
R0127:Muc2 UTSW 7 141,302,691 (GRCm39) missense probably benign 0.00
R0179:Muc2 UTSW 7 141,302,708 (GRCm39) missense probably damaging 1.00
R0201:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0299:Muc2 UTSW 7 141,306,466 (GRCm39) missense probably damaging 1.00
R0547:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0699:Muc2 UTSW 7 141,306,037 (GRCm39) missense probably damaging 1.00
R0900:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1348:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1625:Muc2 UTSW 7 141,283,405 (GRCm39) missense probably damaging 1.00
R2010:Muc2 UTSW 7 141,287,444 (GRCm39) missense probably damaging 0.99
R2149:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R2163:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R3008:Muc2 UTSW 7 141,281,347 (GRCm39) missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3112:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3424:Muc2 UTSW 7 141,279,595 (GRCm39) missense probably damaging 0.99
R3786:Muc2 UTSW 7 141,283,590 (GRCm39) missense probably benign 0.01
R3854:Muc2 UTSW 7 141,308,081 (GRCm39) missense probably damaging 1.00
R3964:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3965:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3966:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3973:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3974:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3976:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R4327:Muc2 UTSW 7 141,281,577 (GRCm39) missense probably damaging 0.96
R4694:Muc2 UTSW 7 141,306,082 (GRCm39) missense probably damaging 1.00
R4764:Muc2 UTSW 7 141,299,345 (GRCm39) missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141,286,260 (GRCm39) critical splice donor site probably null
R4798:Muc2 UTSW 7 141,307,877 (GRCm39) missense probably benign 0.01
R4900:Muc2 UTSW 7 141,303,280 (GRCm39) missense probably benign 0.32
R5383:Muc2 UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
R5489:Muc2 UTSW 7 141,305,169 (GRCm39) missense probably benign 0.00
R5615:Muc2 UTSW 7 141,277,446 (GRCm39) missense probably damaging 1.00
R5856:Muc2 UTSW 7 141,299,381 (GRCm39) unclassified probably benign
R5919:Muc2 UTSW 7 141,281,171 (GRCm39) missense probably damaging 0.97
R5953:Muc2 UTSW 7 141,287,951 (GRCm39) missense probably damaging 0.96
R5979:Muc2 UTSW 7 141,305,143 (GRCm39) missense probably damaging 0.99
R5979:Muc2 UTSW 7 141,283,493 (GRCm39) splice site probably null
R6175:Muc2 UTSW 7 141,282,875 (GRCm39) missense probably damaging 1.00
R6213:Muc2 UTSW 7 141,305,151 (GRCm39) missense probably damaging 1.00
R6281:Muc2 UTSW 7 141,306,140 (GRCm39) missense probably damaging 1.00
R6321:Muc2 UTSW 7 141,287,397 (GRCm39) missense probably benign 0.28
R6390:Muc2 UTSW 7 141,305,883 (GRCm39) missense probably damaging 0.97
R6485:Muc2 UTSW 7 141,300,473 (GRCm39) unclassified probably benign
R6582:Muc2 UTSW 7 141,282,941 (GRCm39) missense probably benign 0.00
R6683:Muc2 UTSW 7 141,305,214 (GRCm39) missense probably benign 0.38
R6896:Muc2 UTSW 7 141,306,432 (GRCm39) missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
R6924:Muc2 UTSW 7 141,284,077 (GRCm39) missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141,305,194 (GRCm39) missense unknown
R7222:Muc2 UTSW 7 141,290,758 (GRCm39) missense
R7251:Muc2 UTSW 7 141,278,965 (GRCm39) missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141,306,481 (GRCm39) missense
R7315:Muc2 UTSW 7 141,276,645 (GRCm39) missense probably damaging 0.99
R7421:Muc2 UTSW 7 141,301,863 (GRCm39) missense
R7556:Muc2 UTSW 7 141,307,439 (GRCm39) missense
R7651:Muc2 UTSW 7 141,290,750 (GRCm39) missense
R7710:Muc2 UTSW 7 141,287,452 (GRCm39) missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141,290,942 (GRCm39) missense
R7813:Muc2 UTSW 7 141,282,543 (GRCm39) splice site probably null
R7843:Muc2 UTSW 7 141,281,662 (GRCm39) missense probably benign 0.03
R7869:Muc2 UTSW 7 141,303,471 (GRCm39) missense
R7924:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
R7993:Muc2 UTSW 7 141,308,173 (GRCm39) missense
R8053:Muc2 UTSW 7 141,284,575 (GRCm39) missense probably benign 0.01
R8068:Muc2 UTSW 7 141,298,422 (GRCm39) missense
R8099:Muc2 UTSW 7 141,299,175 (GRCm39) splice site probably null
R8192:Muc2 UTSW 7 141,305,215 (GRCm39) missense
R8194:Muc2 UTSW 7 141,290,801 (GRCm39) missense
R8545:Muc2 UTSW 7 141,306,130 (GRCm39) missense unknown
R8701:Muc2 UTSW 7 141,281,850 (GRCm39) missense probably damaging 1.00
R8883:Muc2 UTSW 7 141,287,469 (GRCm39) missense probably damaging 0.98
R8894:Muc2 UTSW 7 141,280,758 (GRCm39) missense probably damaging 1.00
R8905:Muc2 UTSW 7 141,279,643 (GRCm39) missense probably benign 0.00
R9024:Muc2 UTSW 7 141,287,936 (GRCm39) missense probably damaging 0.98
R9032:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9085:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9091:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9104:Muc2 UTSW 7 141,286,224 (GRCm39) missense probably damaging 1.00
R9114:Muc2 UTSW 7 141,287,983 (GRCm39) nonsense probably null
R9270:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9297:Muc2 UTSW 7 141,302,759 (GRCm39) missense
R9325:Muc2 UTSW 7 141,298,559 (GRCm39) missense
R9354:Muc2 UTSW 7 141,307,157 (GRCm39) missense
R9386:Muc2 UTSW 7 141,279,389 (GRCm39) missense probably damaging 1.00
R9529:Muc2 UTSW 7 141,287,453 (GRCm39) missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141,308,242 (GRCm39) missense probably damaging 1.00
R9583:Muc2 UTSW 7 141,300,559 (GRCm39) missense
R9607:Muc2 UTSW 7 141,305,190 (GRCm39) missense
R9646:Muc2 UTSW 7 141,276,643 (GRCm39) missense probably benign
R9651:Muc2 UTSW 7 141,288,014 (GRCm39) missense probably damaging 0.99
R9774:Muc2 UTSW 7 141,285,811 (GRCm39) missense probably benign
R9784:Muc2 UTSW 7 141,280,785 (GRCm39) nonsense probably null
Z1176:Muc2 UTSW 7 141,300,451 (GRCm39) missense
Z1177:Muc2 UTSW 7 141,298,531 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TTGGAAGGGAACATCCTGGCAAC -3'
(R):5'- TGAGAGGCACTTACAGCAGACTCC -3'

Sequencing Primer
(F):5'- CCTGGCAACTAGTGACTATTGAG -3'
(R):5'- TACAGCAGACTCCCTGGGTG -3'
Posted On 2017-12-01