Incidental Mutation 'R1574:Dnah2'
ID 500347
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Name dynein, axonemal, heavy chain 2
Synonyms Dnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
MMRRC Submission 045014-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1574 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 69420809-69549110 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69514688 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 666 (V666A)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659] [ENSMUST00000208777]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035539
AA Change: V666A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: V666A

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108659
AA Change: V666A

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: V666A

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154985
Predicted Effect probably benign
Transcript: ENSMUST00000208777
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 96.3%
  • 10x: 84.0%
  • 20x: 52.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Ankrd12 A T 17: 65,986,274 D721E probably benign Het
Anpep A G 7: 79,838,407 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Cenpo A T 12: 4,215,433 probably null Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
D430041D05Rik GTGATGATGATGATGATGATG GTGATGATGATGATGATG 2: 104,221,208 probably benign Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Fndc3a A T 14: 72,556,557 I892N probably damaging Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kcng1 T A 2: 168,269,041 N68Y probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Naca G T 10: 128,040,398 probably benign Het
Ncoa7 T C 10: 30,694,101 I249M probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Zfp949 A T 9: 88,569,777 K467* probably null Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69492672 missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69495066 splice site probably benign
IGL00772:Dnah2 APN 11 69451257 missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69473350 critical splice donor site probably null
IGL00827:Dnah2 APN 11 69448457 missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69478092 missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69493184 missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69475606 missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69432964 missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69474191 splice site probably benign
IGL01480:Dnah2 APN 11 69458371 missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69516080 missense probably benign 0.17
IGL01592:Dnah2 APN 11 69431087 missense probably benign 0.14
IGL01612:Dnah2 APN 11 69465063 splice site probably benign
IGL01667:Dnah2 APN 11 69544395 missense probably benign
IGL01667:Dnah2 APN 11 69520941 missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69539443 missense probably benign
IGL02019:Dnah2 APN 11 69474285 missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69499212 missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69422559 missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69458185 missense probably benign 0.07
IGL02158:Dnah2 APN 11 69458123 missense probably benign
IGL02381:Dnah2 APN 11 69446292 missense probably benign 0.25
IGL02681:Dnah2 APN 11 69452933 missense probably benign 0.40
IGL02957:Dnah2 APN 11 69448507 missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69518414 missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69521187 missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69436291 splice site probably benign
IGL03120:Dnah2 APN 11 69421848 missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69458488 missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69459263 missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69529381 critical splice donor site probably null
IGL03333:Dnah2 APN 11 69495123 missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69496577 missense probably benign 0.13
argyrios UTSW 11 69516590 missense possibly damaging 0.47
Aureus UTSW 11 69429348 missense probably damaging 1.00
platinum UTSW 11 69458042 missense probably damaging 0.96
R0334_dnah2_144 UTSW 11 69436836 missense probably damaging 1.00
R2150_dnah2_212 UTSW 11 69515761 missense probably benign 0.14
BB005:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
BB015:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
E0370:Dnah2 UTSW 11 69515615 splice site probably null
P0026:Dnah2 UTSW 11 69464947 missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69421009 missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69435249 missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69436836 missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69529531 missense probably benign 0.00
R0386:Dnah2 UTSW 11 69447861 missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69499238 missense probably benign 0.26
R0427:Dnah2 UTSW 11 69452879 missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69459288 missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69448542 missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69459201 missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69423126 missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69499194 missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69477683 missense probably benign 0.07
R0924:Dnah2 UTSW 11 69421308 missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69448519 missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69447819 missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69446648 missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69499190 missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69515700 missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69451050 missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69520667 splice site probably null
R1538:Dnah2 UTSW 11 69477202 missense probably benign 0.17
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1590:Dnah2 UTSW 11 69422754 critical splice donor site probably null
R1590:Dnah2 UTSW 11 69521198 missense probably benign 0.00
R1655:Dnah2 UTSW 11 69473854 missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69514691 missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69497889 missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69423543 missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69475574 missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69514804 missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69437886 missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69515752 missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69464930 missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69474325 missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69458358 critical splice donor site probably null
R2016:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69524240 missense probably benign 0.14
R2077:Dnah2 UTSW 11 69496606 missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69455916 missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69493237 missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2128:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2146:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2147:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2150:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2404:Dnah2 UTSW 11 69437221 missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69524206 nonsense probably null
R2517:Dnah2 UTSW 11 69516644 missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69430478 missense probably benign
R3741:Dnah2 UTSW 11 69448469 missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69492650 splice site probably null
R3872:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69451347 missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69454103 missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69484021 missense probably benign 0.00
R4501:Dnah2 UTSW 11 69477659 missense probably benign
R4515:Dnah2 UTSW 11 69465631 missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69483367 missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69463661 missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69465376 missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69496559 missense probably benign 0.00
R4683:Dnah2 UTSW 11 69458942 missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69498532 missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69478077 missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69516590 missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69476688 missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69429357 missense probably benign 0.00
R4740:Dnah2 UTSW 11 69458042 missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69473871 missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69423205 missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69422590 missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69463648 missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69476691 missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69521147 missense probably benign 0.00
R4911:Dnah2 UTSW 11 69499104 critical splice donor site probably null
R4954:Dnah2 UTSW 11 69539496 missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69455973 nonsense probably null
R5015:Dnah2 UTSW 11 69497882 missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69448166 missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69520773 missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69520933 missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69422536 missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69435884 missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5208:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5252:Dnah2 UTSW 11 69529469 missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5298:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5299:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5301:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5324:Dnah2 UTSW 11 69457993 missense probably benign 0.07
R5350:Dnah2 UTSW 11 69516036 missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69421848 missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69500857 missense probably benign
R5421:Dnah2 UTSW 11 69435636 missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69524383 missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69473351 critical splice donor site probably null
R5474:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5476:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5477:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5510:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5527:Dnah2 UTSW 11 69437188 nonsense probably null
R5566:Dnah2 UTSW 11 69516569 nonsense probably null
R5587:Dnah2 UTSW 11 69437242 missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5688:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5690:Dnah2 UTSW 11 69491544 missense probably benign 0.15
R5711:Dnah2 UTSW 11 69435390 missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69430817 missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5913:Dnah2 UTSW 11 69448430 missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5960:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5961:Dnah2 UTSW 11 69431148 missense probably damaging 1.00
R5961:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5977:Dnah2 UTSW 11 69520881 missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69500839 missense probably benign
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6050:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6086:Dnah2 UTSW 11 69516008 missense probably benign 0.30
R6115:Dnah2 UTSW 11 69446649 missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69518359 missense probably benign 0.29
R6159:Dnah2 UTSW 11 69458542 missense probably damaging 1.00
R6159:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6163:Dnah2 UTSW 11 69520903 nonsense probably null
R6171:Dnah2 UTSW 11 69423042 missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69457412 missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69491641 missense probably benign 0.25
R6352:Dnah2 UTSW 11 69448227 missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69458518 missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69539415 missense probably benign
R6478:Dnah2 UTSW 11 69516010 missense probably benign 0.01
R6516:Dnah2 UTSW 11 69465386 missense probably benign 0.34
R6538:Dnah2 UTSW 11 69437197 missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69423690 missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69455963 missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69429471 missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69484260 missense probably benign 0.12
R6935:Dnah2 UTSW 11 69421741 missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69491547 nonsense probably null
R7073:Dnah2 UTSW 11 69430492 nonsense probably null
R7111:Dnah2 UTSW 11 69446753 splice site probably null
R7125:Dnah2 UTSW 11 69436182 missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69491555 missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69549097 splice site probably null
R7214:Dnah2 UTSW 11 69431109 missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69421396 missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69459146 critical splice donor site probably null
R7256:Dnah2 UTSW 11 69431094 missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69500817 missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69478797 missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69492805 missense probably benign 0.25
R7437:Dnah2 UTSW 11 69498627 missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7473:Dnah2 UTSW 11 69491658 missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69500796 missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7615:Dnah2 UTSW 11 69435304 missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69498685 missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69451318 nonsense probably null
R7764:Dnah2 UTSW 11 69458158 missense probably benign 0.29
R7793:Dnah2 UTSW 11 69495214 missense probably benign 0.00
R7819:Dnah2 UTSW 11 69516593 missense probably benign 0.01
R7881:Dnah2 UTSW 11 69431238 missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69518428 missense probably damaging 1.00
R7916:Dnah2 UTSW 11 69421148 critical splice acceptor site probably null
R7921:Dnah2 UTSW 11 69520834 missense probably benign
R7928:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
R7937:Dnah2 UTSW 11 69517685 nonsense probably null
R7995:Dnah2 UTSW 11 69520737 missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69478823 missense probably benign 0.00
R8208:Dnah2 UTSW 11 69520852 missense probably benign 0.05
R8215:Dnah2 UTSW 11 69435367 missense probably damaging 1.00
R8279:Dnah2 UTSW 11 69475573 missense probably damaging 1.00
R8338:Dnah2 UTSW 11 69487296 missense probably damaging 1.00
R8348:Dnah2 UTSW 11 69429447 missense possibly damaging 0.95
R8405:Dnah2 UTSW 11 69458463 missense probably damaging 1.00
R8407:Dnah2 UTSW 11 69459278 missense probably benign 0.00
R8493:Dnah2 UTSW 11 69452978 missense probably damaging 1.00
R8673:Dnah2 UTSW 11 69514697 missense probably benign 0.23
R8725:Dnah2 UTSW 11 69524179 missense probably damaging 1.00
R8727:Dnah2 UTSW 11 69524179 missense probably damaging 1.00
R8730:Dnah2 UTSW 11 69493261 missense possibly damaging 0.73
R8804:Dnah2 UTSW 11 69465685 missense probably benign 0.01
R8876:Dnah2 UTSW 11 69491522 missense probably damaging 1.00
R8894:Dnah2 UTSW 11 69492222 missense probably benign 0.01
R8938:Dnah2 UTSW 11 69437928 missense probably damaging 0.99
R9044:Dnah2 UTSW 11 69529421 missense probably benign
R9085:Dnah2 UTSW 11 69429398 missense possibly damaging 0.69
R9110:Dnah2 UTSW 11 69544382 missense probably benign
R9156:Dnah2 UTSW 11 69422861 missense
R9251:Dnah2 UTSW 11 69515793 missense probably damaging 1.00
R9258:Dnah2 UTSW 11 69477253 missense probably damaging 1.00
R9279:Dnah2 UTSW 11 69518278 missense probably benign 0.01
R9318:Dnah2 UTSW 11 69484329 missense probably benign 0.07
R9321:Dnah2 UTSW 11 69448113 critical splice donor site probably null
R9350:Dnah2 UTSW 11 69493247 missense probably benign 0.10
R9358:Dnah2 UTSW 11 69515766 missense probably damaging 0.99
R9417:Dnah2 UTSW 11 69436164 missense probably damaging 1.00
R9420:Dnah2 UTSW 11 69478116 missense probably benign 0.09
R9438:Dnah2 UTSW 11 69473394 missense probably damaging 1.00
R9469:Dnah2 UTSW 11 69431070 missense probably damaging 1.00
R9487:Dnah2 UTSW 11 69515791 missense possibly damaging 0.47
R9495:Dnah2 UTSW 11 69454382 missense possibly damaging 0.89
R9579:Dnah2 UTSW 11 69477215 missense probably damaging 1.00
R9608:Dnah2 UTSW 11 69454062 missense probably null 1.00
R9651:Dnah2 UTSW 11 69450998 critical splice donor site probably null
R9662:Dnah2 UTSW 11 69452937 missense probably benign
RF004:Dnah2 UTSW 11 69437187 missense probably benign 0.24
U24488:Dnah2 UTSW 11 69483822 missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69448562 missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69430793 missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69421821 missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69451120 missense probably benign
Z1176:Dnah2 UTSW 11 69487054 missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69498667 missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69516481 missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69516523 missense probably damaging 1.00
Z1177:Dnah2 UTSW 11 69463453 missense possibly damaging 0.63
Z1177:Dnah2 UTSW 11 69544557 critical splice acceptor site probably null
Predicted Primers
Posted On 2017-12-01