Incidental Mutation 'R0543:Strip1'
ID50039
Institutional Source Beutler Lab
Gene Symbol Strip1
Ensembl Gene ENSMUSG00000014601
Gene Namestriatin interacting protein 1
Synonyms
MMRRC Submission 038735-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R0543 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107612532-107631694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107626775 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 181 (T181M)
Ref Sequence ENSEMBL: ENSMUSP00000068587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064759] [ENSMUST00000106703]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064759
AA Change: T181M

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068587
Gene: ENSMUSG00000014601
AA Change: T181M

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
N1221 65 363 7.87e-138 SMART
low complexity region 376 394 N/A INTRINSIC
DUF3402 460 817 6.87e-202 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198424
Meta Mutation Damage Score 0.0841 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the striatin-interacting phosphatase and kinase complex, which is involved in localization of the Golgi body. The encoded protein participates in cytosketelal organization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, shortened anterior-posterior axis, cinching of tissue at the embryonic/extraembryonic boundary and abnormal mesoderm development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Col28a1 T A 6: 8,075,326 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Git2 G T 5: 114,745,531 H42Q probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hars2 G A 18: 36,789,424 E337K probably damaging Het
Hells A G 19: 38,967,750 R797G probably benign Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mtch2 T C 2: 90,849,682 V86A possibly damaging Het
Mttp A T 3: 138,111,696 I446N possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nostrin T G 2: 69,189,131 *507E probably null Het
Nup205 T C 6: 35,198,969 V589A probably benign Het
Olfr1141 C A 2: 87,753,650 L114F probably damaging Het
Olfr1444 G T 19: 12,861,888 V38F probably benign Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pdzd3 A C 9: 44,248,934 H324Q probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Strip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Strip1 APN 3 107621445 missense probably damaging 0.99
IGL01150:Strip1 APN 3 107626731 splice site probably null
IGL01484:Strip1 APN 3 107613259 missense probably damaging 0.99
IGL01862:Strip1 APN 3 107621882 missense probably damaging 0.99
IGL02425:Strip1 APN 3 107614646 missense probably benign 0.08
IGL02537:Strip1 APN 3 107616894 missense possibly damaging 0.94
IGL02948:Strip1 APN 3 107613266 missense probably benign 0.33
IGL03179:Strip1 APN 3 107620255 missense probably damaging 0.99
PIT4472001:Strip1 UTSW 3 107628170 missense probably benign 0.19
R0197:Strip1 UTSW 3 107614613 missense probably damaging 0.99
R0526:Strip1 UTSW 3 107620039 critical splice donor site probably null
R0883:Strip1 UTSW 3 107614613 missense probably damaging 0.99
R1070:Strip1 UTSW 3 107627408 missense possibly damaging 0.81
R1384:Strip1 UTSW 3 107626839 missense probably benign 0.00
R1467:Strip1 UTSW 3 107627408 missense possibly damaging 0.81
R1467:Strip1 UTSW 3 107627408 missense possibly damaging 0.81
R1772:Strip1 UTSW 3 107626731 splice site probably null
R2358:Strip1 UTSW 3 107615819 missense probably benign 0.01
R2484:Strip1 UTSW 3 107628221 missense possibly damaging 0.81
R2931:Strip1 UTSW 3 107625659 intron probably null
R3427:Strip1 UTSW 3 107616822 missense possibly damaging 0.68
R4584:Strip1 UTSW 3 107624503 missense probably benign 0.39
R4780:Strip1 UTSW 3 107626998 missense probably benign 0.01
R4853:Strip1 UTSW 3 107616916 missense possibly damaging 0.93
R5623:Strip1 UTSW 3 107626826 missense possibly damaging 0.69
R5801:Strip1 UTSW 3 107621441 missense possibly damaging 0.50
R6345:Strip1 UTSW 3 107628200 missense probably damaging 1.00
R6860:Strip1 UTSW 3 107618936 missense possibly damaging 0.50
R6869:Strip1 UTSW 3 107613445 missense probably damaging 1.00
R7022:Strip1 UTSW 3 107626795 missense probably benign 0.09
R7192:Strip1 UTSW 3 107615335 missense possibly damaging 0.94
R7387:Strip1 UTSW 3 107625730 missense probably damaging 0.99
R7631:Strip1 UTSW 3 107616931 missense possibly damaging 0.46
R8032:Strip1 UTSW 3 107618078 missense probably damaging 0.99
Z1177:Strip1 UTSW 3 107615769 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATTACAGAGTGTGTGGAGCCAG -3'
(R):5'- CGAGCCATTCTCTATGTTGCCCAAG -3'

Sequencing Primer
(F):5'- TCATTACATCCTAGCAGCATGG -3'
(R):5'- CCAAGGTACTGTGAGTATGACCC -3'
Posted On2013-06-12