Incidental Mutation 'R0543:Mttp'
ID50041
Institutional Source Beutler Lab
Gene Symbol Mttp
Ensembl Gene ENSMUSG00000028158
Gene Namemicrosomal triglyceride transfer protein
Synonyms1810043K16Rik, MTP
MMRRC Submission 038735-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.814) question?
Stock #R0543 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138089854-138144968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138111696 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 446 (I446N)
Ref Sequence ENSEMBL: ENSMUSP00000096179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029805] [ENSMUST00000098580]
Predicted Effect probably benign
Transcript: ENSMUST00000029805
AA Change: I431N

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029805
Gene: ENSMUSG00000028158
AA Change: I431N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LPD_N 28 579 8.87e-165 SMART
Blast:LPD_N 582 695 4e-58 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000098580
AA Change: I446N

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096179
Gene: ENSMUSG00000028158
AA Change: I446N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LPD_N 43 594 8.87e-165 SMART
Blast:LPD_N 597 710 6e-58 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196625
Meta Mutation Damage Score 0.5954 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a reporter allele die at midgestation displaying delayed growth, neurodevelopmental anomalies, impaired erythropoiesis, deficient yolk sac lipoprotein production, hemorrhage and necrosis. Heterozygous mutant mice display altered plasma lipid and lipoprotein profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Col28a1 T A 6: 8,075,326 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Git2 G T 5: 114,745,531 H42Q probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hars2 G A 18: 36,789,424 E337K probably damaging Het
Hells A G 19: 38,967,750 R797G probably benign Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mtch2 T C 2: 90,849,682 V86A possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nostrin T G 2: 69,189,131 *507E probably null Het
Nup205 T C 6: 35,198,969 V589A probably benign Het
Olfr1141 C A 2: 87,753,650 L114F probably damaging Het
Olfr1444 G T 19: 12,861,888 V38F probably benign Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pdzd3 A C 9: 44,248,934 H324Q probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Strip1 G A 3: 107,626,775 T181M possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Mttp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Mttp APN 3 138109015 missense possibly damaging 0.84
IGL00983:Mttp APN 3 138115129 splice site probably benign
IGL01128:Mttp APN 3 138133997 splice site probably null
IGL01607:Mttp APN 3 138104698 missense probably damaging 0.99
IGL01760:Mttp APN 3 138111736 missense probably benign 0.00
IGL01947:Mttp APN 3 138107129 missense probably damaging 1.00
IGL02184:Mttp APN 3 138116000 critical splice donor site probably null
IGL02932:Mttp APN 3 138111744 missense probably benign 0.07
IGL02957:Mttp APN 3 138109081 missense possibly damaging 0.95
IGL03082:Mttp APN 3 138123795 missense probably benign 0.01
IGL03302:Mttp APN 3 138104707 missense possibly damaging 0.90
IGL03381:Mttp APN 3 138104943 missense probably damaging 1.00
P0040:Mttp UTSW 3 138112566 missense possibly damaging 0.82
R0738:Mttp UTSW 3 138103313 missense probably damaging 1.00
R0967:Mttp UTSW 3 138092723 missense probably benign 0.00
R1281:Mttp UTSW 3 138107219 missense possibly damaging 0.95
R1565:Mttp UTSW 3 138116405 critical splice donor site probably null
R1660:Mttp UTSW 3 138103193 missense probably damaging 1.00
R1828:Mttp UTSW 3 138107280 missense probably damaging 1.00
R1886:Mttp UTSW 3 138092615 missense probably damaging 1.00
R1912:Mttp UTSW 3 138116027 missense probably benign 0.01
R1938:Mttp UTSW 3 138125121 missense probably benign 0.21
R2020:Mttp UTSW 3 138118402 missense probably damaging 0.98
R2109:Mttp UTSW 3 138095002 missense probably benign 0.27
R2336:Mttp UTSW 3 138116095 missense possibly damaging 0.81
R2392:Mttp UTSW 3 138095021 missense probably damaging 0.98
R3021:Mttp UTSW 3 138111703 missense probably benign
R3774:Mttp UTSW 3 138114263 intron probably null
R3776:Mttp UTSW 3 138114263 intron probably null
R4687:Mttp UTSW 3 138092735 missense possibly damaging 0.66
R4708:Mttp UTSW 3 138134098 unclassified probably benign
R4756:Mttp UTSW 3 138116071 missense possibly damaging 0.77
R4832:Mttp UTSW 3 138116050 missense probably benign
R5377:Mttp UTSW 3 138105029 missense probably benign 0.03
R5670:Mttp UTSW 3 138125113 missense probably damaging 0.99
R6613:Mttp UTSW 3 138109078 missense probably damaging 1.00
R6725:Mttp UTSW 3 138107238 missense probably damaging 1.00
R6799:Mttp UTSW 3 138095080 missense probably benign 0.04
R6920:Mttp UTSW 3 138115282 missense possibly damaging 0.49
R7074:Mttp UTSW 3 138107273 missense possibly damaging 0.53
R7131:Mttp UTSW 3 138116132 missense probably benign 0.13
R7275:Mttp UTSW 3 138123785 missense probably benign 0.19
R7291:Mttp UTSW 3 138091203 missense probably damaging 1.00
R7310:Mttp UTSW 3 138095022 missense probably damaging 1.00
R7769:Mttp UTSW 3 138103112 missense probably damaging 1.00
R7909:Mttp UTSW 3 138118417 nonsense probably null
R7990:Mttp UTSW 3 138118417 nonsense probably null
R8037:Mttp UTSW 3 138091122 missense probably damaging 1.00
Z1176:Mttp UTSW 3 138104779 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGTGGGCACTAGACTATGACG -3'
(R):5'- AAGATCATTTGGGGCCAGGCAG -3'

Sequencing Primer
(F):5'- TCAGCAGCATGGCGTTAC -3'
(R):5'- AGGCAGTCTAGCAATCCTTC -3'
Posted On2013-06-12