Incidental Mutation 'R0543:Git2'
ID 50047
Institutional Source Beutler Lab
Gene Symbol Git2
Ensembl Gene ENSMUSG00000041890
Gene Name G protein-coupled receptor kinase-interactor 2
Synonyms 5830420E16Rik, Cool associated tyrosine phosphorylated-2, ARF GTPase activating protein 2, 9630056M03Rik, B230104M05Rik, 1500036H07Rik, Cat-2
MMRRC Submission 038735-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R0543 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 114727407-114775517 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 114745531 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 42 (H42Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043283] [ENSMUST00000086564] [ENSMUST00000112183] [ENSMUST00000112185] [ENSMUST00000131993] [ENSMUST00000146044] [ENSMUST00000155908] [ENSMUST00000178440]
AlphaFold Q9JLQ2
Predicted Effect probably benign
Transcript: ENSMUST00000043283
AA Change: H380Q

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039718
Gene: ENSMUSG00000041890
AA Change: H380Q

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 266 296 4.96e-10 SMART
GIT 330 360 1.27e-7 SMART
Pfam:GIT1_C 550 674 2.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086564
AA Change: H380Q

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000083754
Gene: ENSMUSG00000041890
AA Change: H380Q

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 266 296 4.96e-10 SMART
GIT 330 360 1.27e-7 SMART
Pfam:GIT_CC 414 478 3.7e-31 PFAM
low complexity region 555 570 N/A INTRINSIC
Pfam:GIT1_C 636 752 6.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112183
AA Change: H382Q

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107801
Gene: ENSMUSG00000041890
AA Change: H382Q

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 268 298 4.96e-10 SMART
GIT 332 362 1.27e-7 SMART
Pfam:GIT1_C 552 676 1e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112185
AA Change: H379Q

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107803
Gene: ENSMUSG00000041890
AA Change: H379Q

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 265 295 4.96e-10 SMART
GIT 329 359 1.27e-7 SMART
low complexity region 504 519 N/A INTRINSIC
Pfam:GIT1_C 579 703 3e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130925
AA Change: H42Q

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115185
Gene: ENSMUSG00000041890
AA Change: H42Q

DomainStartEndE-ValueType
Pfam:GIT_SHD 1 21 9.7e-5 PFAM
Pfam:GIT_CC 77 115 7.7e-14 PFAM
low complexity region 203 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131993
SMART Domains Protein: ENSMUSP00000118812
Gene: ENSMUSG00000041890

DomainStartEndE-ValueType
ANK 21 50 2.55e2 SMART
ANK 55 84 1.21e1 SMART
ANK 88 117 3.95e1 SMART
Pfam:GIT_SHD 156 186 7.9e-19 PFAM
Pfam:GIT_SHD 220 249 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146044
SMART Domains Protein: ENSMUSP00000115988
Gene: ENSMUSG00000041890

DomainStartEndE-ValueType
PDB:2W6A|B 3 59 5e-16 PDB
Pfam:GIT1_C 182 306 2.4e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153756
Predicted Effect probably benign
Transcript: ENSMUST00000155908
AA Change: H380Q

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122302
Gene: ENSMUSG00000041890
AA Change: H380Q

DomainStartEndE-ValueType
ArfGap 1 96 2.04e-25 SMART
ANK 104 133 2.55e2 SMART
ANK 138 167 1.21e1 SMART
ANK 171 200 3.95e1 SMART
GIT 238 268 4.96e-10 SMART
GIT 302 332 1.27e-7 SMART
Pfam:GIT1_C 474 598 8.3e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178440
AA Change: H381Q

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136796
Gene: ENSMUSG00000041890
AA Change: H381Q

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 267 297 4.96e-10 SMART
GIT 331 361 1.27e-7 SMART
Pfam:GIT1_C 551 675 2.4e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201442
Meta Mutation Damage Score 0.0740 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GIT protein family, which interact with G protein-coupled receptor kinases and possess ADP-ribosylation factor (ARF) GTPase-activating protein (GAP) activity. GIT proteins traffic between cytoplasmic complexes, focal adhesions, and the cell periphery, and interact with Pak interacting exchange factor beta (PIX) to form large oligomeric complexes that transiently recruit other proteins. GIT proteins regulate cytoskeletal dynamics and participate in receptor internalization and membrane trafficking. This gene has been shown to repress lamellipodial extension and focal adhesion turnover, and is thought to regulate cell motility. This gene undergoes extensive alternative splicing to generate multiple isoforms, but the full-length nature of some of these variants has not been determined. The various isoforms have functional differences, with respect to ARF GAP activity and to G protein-coupled receptor kinase 2 binding. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele show frequent splenomegaly, extramedullary hematopoiesis, impaired neutrophil chemotaxis, misoriented hyperproduction of superoxide anions and increased susceptibility to fungal infection. Homozygotes for a gene trap allele have reduced marginal zone B cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Col28a1 T A 6: 8,075,326 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hars2 G A 18: 36,789,424 E337K probably damaging Het
Hells A G 19: 38,967,750 R797G probably benign Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mtch2 T C 2: 90,849,682 V86A possibly damaging Het
Mttp A T 3: 138,111,696 I446N possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nostrin T G 2: 69,189,131 *507E probably null Het
Nup205 T C 6: 35,198,969 V589A probably benign Het
Olfr1141 C A 2: 87,753,650 L114F probably damaging Het
Olfr1444 G T 19: 12,861,888 V38F probably benign Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pdzd3 A C 9: 44,248,934 H324Q probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Strip1 G A 3: 107,626,775 T181M possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Git2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Git2 APN 5 114767105 missense probably damaging 1.00
IGL02538:Git2 APN 5 114730986 splice site probably benign
IGL03114:Git2 APN 5 114733857 splice site probably benign
IGL03278:Git2 APN 5 114745579 splice site probably benign
IGL03278:Git2 APN 5 114745580 splice site probably null
bridge UTSW 5 114749560 critical splice donor site probably null
hashi UTSW 5 114769615 critical splice donor site probably null
ponto UTSW 5 114739101 missense probably damaging 1.00
vecchio UTSW 5 114769698 nonsense probably null
R0184:Git2 UTSW 5 114739037 missense possibly damaging 0.47
R0241:Git2 UTSW 5 114733229 missense probably damaging 1.00
R0241:Git2 UTSW 5 114733229 missense probably damaging 1.00
R0540:Git2 UTSW 5 114748274 missense probably damaging 1.00
R0612:Git2 UTSW 5 114752281 missense probably damaging 1.00
R1144:Git2 UTSW 5 114753314 missense probably benign 0.27
R1225:Git2 UTSW 5 114733178 splice site probably benign
R1783:Git2 UTSW 5 114739124 missense probably damaging 1.00
R1923:Git2 UTSW 5 114739101 missense probably damaging 1.00
R1956:Git2 UTSW 5 114749337 nonsense probably null
R1981:Git2 UTSW 5 114749559 splice site probably benign
R2029:Git2 UTSW 5 114766450 critical splice donor site probably null
R3150:Git2 UTSW 5 114730349 missense probably damaging 1.00
R4087:Git2 UTSW 5 114764405 missense probably damaging 0.99
R4367:Git2 UTSW 5 114764666 missense probably damaging 1.00
R4400:Git2 UTSW 5 114733909 missense possibly damaging 0.94
R4702:Git2 UTSW 5 114745482 missense probably damaging 1.00
R4758:Git2 UTSW 5 114730351 missense probably damaging 1.00
R4840:Git2 UTSW 5 114745482 missense probably damaging 1.00
R5236:Git2 UTSW 5 114767172 missense probably damaging 1.00
R5427:Git2 UTSW 5 114730328 missense possibly damaging 0.82
R5510:Git2 UTSW 5 114743774 critical splice donor site probably null
R6014:Git2 UTSW 5 114733877 missense probably benign 0.32
R6162:Git2 UTSW 5 114761656 missense probably damaging 0.99
R6195:Git2 UTSW 5 114767114 missense probably benign 0.27
R6198:Git2 UTSW 5 114745495 nonsense probably null
R6233:Git2 UTSW 5 114767114 missense probably benign 0.27
R6277:Git2 UTSW 5 114733247 missense probably damaging 1.00
R6603:Git2 UTSW 5 114730991 critical splice donor site probably null
R7141:Git2 UTSW 5 114769698 nonsense probably null
R7420:Git2 UTSW 5 114730370 missense probably benign 0.00
R7468:Git2 UTSW 5 114733897 missense probably damaging 1.00
R7574:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7575:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7577:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7651:Git2 UTSW 5 114733235 missense probably damaging 1.00
R7658:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7893:Git2 UTSW 5 114769676 missense possibly damaging 0.83
R8067:Git2 UTSW 5 114766518 missense probably damaging 0.99
R8415:Git2 UTSW 5 114733928 missense possibly damaging 0.80
R8878:Git2 UTSW 5 114761588 missense possibly damaging 0.95
R8984:Git2 UTSW 5 114730195 missense probably damaging 0.99
R9022:Git2 UTSW 5 114769615 critical splice donor site probably null
R9084:Git2 UTSW 5 114764454 missense probably damaging 0.99
R9117:Git2 UTSW 5 114749560 critical splice donor site probably null
R9234:Git2 UTSW 5 114761621 missense possibly damaging 0.91
R9488:Git2 UTSW 5 114766472 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGAGCCTAACTTGAGCCCTCTCAC -3'
(R):5'- TGGGAAGCATTGGAACTGCTCTG -3'

Sequencing Primer
(F):5'- actggcgagcactccac -3'
(R):5'- CATTGGAACTGCTCTGTGTGAC -3'
Posted On 2013-06-12