Incidental Mutation 'R3921:Fam228a'
ID500472
Institutional Source Beutler Lab
Gene Symbol Fam228a
Ensembl Gene ENSMUSG00000079177
Gene Namefamily with sequence similarity 228, member A
Synonyms
MMRRC Submission 040818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3921 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location4713670-4738430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4731506 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 118 (T118A)
Ref Sequence ENSEMBL: ENSMUSP00000152506 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000111154
AA Change: T118A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220075
Predicted Effect probably benign
Transcript: ENSMUST00000220978
AA Change: T105A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000222363
AA Change: T118A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,774,202 F16S probably benign Het
Aebp2 C T 6: 140,633,735 R11C probably damaging Het
Anxa8 T C 14: 34,094,446 F201L probably damaging Het
Bcl7a A G 5: 123,371,073 N206S probably benign Het
Birc6 A G 17: 74,627,019 N2542D probably damaging Het
Cubn A G 2: 13,326,677 Y2562H probably damaging Het
Dnah12 C G 14: 26,771,051 D1256E probably damaging Het
Dnajb14 A T 3: 137,904,852 R280S probably damaging Het
Dopey1 A T 9: 86,520,271 I1173F probably benign Het
Gata2 TGCCATGGGCTAGGCAAGCC TGCC 6: 88,205,482 probably null Het
Gm5538 T A 3: 59,752,077 L317Q probably damaging Het
Hif3a T C 7: 17,037,172 D618G possibly damaging Het
Ighv1-43 C A 12: 114,946,152 G50V probably benign Het
Lrrc37a G T 11: 103,501,470 T1043N probably benign Het
Masp2 T A 4: 148,605,731 D232E possibly damaging Het
Ms4a4a A C 19: 11,378,808 Q19P probably benign Het
Nckipsd A G 9: 108,814,076 E399G possibly damaging Het
Nnt T A 13: 119,366,494 T572S probably damaging Het
Olfr1247 C T 2: 89,609,509 V198I probably benign Het
Olfr480 T A 7: 108,065,901 D299V possibly damaging Het
Olig3 A G 10: 19,356,675 D16G probably damaging Het
Polr2b T C 5: 77,326,653 Y446H probably damaging Het
Prtg T C 9: 72,848,347 V277A probably damaging Het
Rnf31 T C 14: 55,601,142 Y857H probably damaging Het
Serac1 T C 17: 6,066,792 D163G probably damaging Het
Slc22a22 C A 15: 57,256,544 V197F probably benign Het
Slc2a10 C T 2: 165,515,601 P394S probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
St7 A G 6: 17,846,245 N120D probably benign Het
Sult2a6 C T 7: 14,254,743 V31M possibly damaging Het
Taf3 T C 2: 10,048,298 T35A probably benign Het
Tmem131l A G 3: 83,940,601 I319T possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l T TTGGATG 15: 10,537,563 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r9 T G 5: 108,849,055 Y116S probably benign Het
Vstm2l A G 2: 157,935,363 T54A probably benign Het
Xrn1 T A 9: 95,969,284 M153K probably benign Het
Zfp106 G A 2: 120,533,616 P770L probably damaging Het
Other mutations in Fam228a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Fam228a APN 12 4732773 missense possibly damaging 0.94
IGL01472:Fam228a APN 12 4715610 missense possibly damaging 0.64
IGL02602:Fam228a APN 12 4732808 missense probably benign 0.00
IGL02797:Fam228a APN 12 4731484 missense probably damaging 1.00
IGL03247:Fam228a APN 12 4737734 missense probably damaging 1.00
R0332:Fam228a UTSW 12 4735018 missense probably damaging 1.00
R0437:Fam228a UTSW 12 4732759 missense probably damaging 1.00
R0454:Fam228a UTSW 12 4731457 missense probably damaging 1.00
R0838:Fam228a UTSW 12 4735002 missense possibly damaging 0.92
R1791:Fam228a UTSW 12 4732748 missense probably damaging 1.00
R1836:Fam228a UTSW 12 4715620 missense probably damaging 1.00
R2256:Fam228a UTSW 12 4737775 start gained probably benign
R2257:Fam228a UTSW 12 4737775 start gained probably benign
R2397:Fam228a UTSW 12 4718718 missense probably benign 0.22
R3731:Fam228a UTSW 12 4718671 missense probably benign 0.44
R5937:Fam228a UTSW 12 4737725 missense probably damaging 1.00
R7278:Fam228a UTSW 12 4732790 missense probably benign 0.01
R7610:Fam228a UTSW 12 4731423 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCTGGGACTGGAGCAATG -3'
(R):5'- TCAATGAAGCATCCCCACTG -3'

Sequencing Primer
(F):5'- ACTGGAGCAATGGGGCCTG -3'
(R):5'- TGGAGACAGGCTCACCCATG -3'
Posted On2017-12-01