Incidental Mutation 'R4062:Usp18'
ID500477
Institutional Source Beutler Lab
Gene Symbol Usp18
Ensembl Gene ENSMUSG00000030107
Gene Nameubiquitin specific peptidase 18
Synonyms1110058H21Rik, UBP43
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location121245906-121270917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121261367 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 158 (T158A)
Ref Sequence ENSEMBL: ENSMUSP00000032198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032198]
Predicted Effect probably benign
Transcript: ENSMUST00000032198
AA Change: T158A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032198
Gene: ENSMUSG00000030107
AA Change: T158A

DomainStartEndE-ValueType
Pfam:UCH 51 363 3.1e-41 PFAM
Pfam:UCH_1 52 335 6.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204926
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiquitin-specific proteases (UBP) family of enzymes that cleave ubiquitin from ubiquitinated protein substrates. It is highly expressed in liver and thymus, and is localized to the nucleus. This protein efficiently cleaves only ISG15 (a ubiquitin-like protein) fusions, and deletion of this gene in mice results in a massive increase of ISG15 conjugates in tissues, indicating that this protein is a major ISG15-specific protease. Mice lacking this gene are also hypersensitive to interferon, suggesting a function of this protein in downregulating interferon responses, independent of its isopeptidase activity towards ISG15. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mutants die prematurely with cellular necrosis in the ependyma, breakdown of blood-brain barrier, hydrocephaly with enlarged ventricles, and severe neurological abnormalities. Mice homozygous for an ENU-induced allele exhibit increased susceptibility to Salmonella infection and LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Usp18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Usp18 APN 6 121255382 nonsense probably null
IGL01403:Usp18 APN 6 121268668 missense possibly damaging 0.67
IGL01411:Usp18 APN 6 121261421 missense probably benign 0.01
IGL01810:Usp18 APN 6 121253771 missense probably damaging 1.00
IGL02568:Usp18 APN 6 121261091 missense probably benign 0.00
IGL02613:Usp18 APN 6 121261090 missense probably benign 0.11
R0961:Usp18 UTSW 6 121261493 missense probably benign 0.00
R1350:Usp18 UTSW 6 121262692 missense possibly damaging 0.64
R1855:Usp18 UTSW 6 121262117 missense probably benign 0.07
R1916:Usp18 UTSW 6 121268554 missense probably benign 0.14
R1981:Usp18 UTSW 6 121252517 missense probably benign 0.08
R2015:Usp18 UTSW 6 121268550 missense probably damaging 1.00
R5000:Usp18 UTSW 6 121252520 missense possibly damaging 0.84
R5894:Usp18 UTSW 6 121261497 missense probably benign 0.03
R6006:Usp18 UTSW 6 121262822 missense possibly damaging 0.58
R6932:Usp18 UTSW 6 121252514 missense probably benign 0.01
R7357:Usp18 UTSW 6 121253849 missense possibly damaging 0.90
Z1177:Usp18 UTSW 6 121255275
Predicted Primers
Posted On2017-12-01