Incidental Mutation 'R4076:Pou2f2'
ID 500479
Institutional Source Beutler Lab
Gene Symbol Pou2f2
Ensembl Gene ENSMUSG00000008496
Gene Name POU domain, class 2, transcription factor 2
Synonyms Oct-2, Otf2, Oct2c, Oct2d, Otf-2, Oct2a, Oct2b
MMRRC Submission 040975-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 24790111-24879292 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24796713 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 270 (T270A)
Ref Sequence ENSEMBL: ENSMUSP00000104053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098679] [ENSMUST00000108413] [ENSMUST00000108415] [ENSMUST00000108416] [ENSMUST00000108417] [ENSMUST00000108418] [ENSMUST00000147146] [ENSMUST00000175774] [ENSMUST00000176408]
AlphaFold Q00196
Predicted Effect possibly damaging
Transcript: ENSMUST00000098679
AA Change: T276A

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096276
Gene: ENSMUSG00000008496
AA Change: T276A

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108413
AA Change: T254A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104051
Gene: ENSMUSG00000008496
AA Change: T254A

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 373 400 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108415
AA Change: T270A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104053
Gene: ENSMUSG00000008496
AA Change: T270A

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108416
AA Change: T215A

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104054
Gene: ENSMUSG00000008496
AA Change: T215A

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 81 97 N/A INTRINSIC
POU 140 214 7.65e-52 SMART
low complexity region 220 233 N/A INTRINSIC
HOX 242 304 3.8e-18 SMART
low complexity region 331 355 N/A INTRINSIC
low complexity region 361 371 N/A INTRINSIC
low complexity region 372 395 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108417
AA Change: T276A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104055
Gene: ENSMUSG00000008496
AA Change: T276A

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108418
AA Change: T254A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104056
Gene: ENSMUSG00000008496
AA Change: T254A

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
low complexity region 490 509 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147146
SMART Domains Protein: ENSMUSP00000118307
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
SCOP:d1gkub1 89 123 2e-3 SMART
low complexity region 134 151 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175774
AA Change: T254A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135075
Gene: ENSMUSG00000008496
AA Change: T254A

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176408
AA Change: T270A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135326
Gene: ENSMUSG00000008496
AA Change: T270A

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184150
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this locus results in failed B cell maturation and death within hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,297,981 (GRCm39) L206H probably benign Het
Adam34l A T 8: 44,079,387 (GRCm39) F279Y probably damaging Het
Anxa5 T C 3: 36,504,529 (GRCm39) I277V probably benign Het
Atg12 A G 18: 46,870,491 (GRCm39) F92L probably benign Het
Cd48 T A 1: 171,523,451 (GRCm39) V98D probably damaging Het
Dnah11 A G 12: 118,009,413 (GRCm39) M2083T probably benign Het
Dnah9 T C 11: 65,975,730 (GRCm39) T1440A probably benign Het
Dnali1 T C 4: 124,953,263 (GRCm39) D188G probably damaging Het
Dst A G 1: 34,231,350 (GRCm39) E2656G probably benign Het
Eps15l1 A G 8: 73,134,128 (GRCm39) I482T probably damaging Het
Ercc4 G A 16: 12,948,549 (GRCm39) V499I probably damaging Het
Eva1c T A 16: 90,701,019 (GRCm39) F331Y probably damaging Het
Fcho1 T C 8: 72,163,013 (GRCm39) H672R probably damaging Het
Fras1 G C 5: 96,891,017 (GRCm39) D2849H probably damaging Het
Hdc C T 2: 126,458,181 (GRCm39) R47Q possibly damaging Het
Ighv1-30 C T 12: 114,781,021 (GRCm39) noncoding transcript Het
Krtap31-1 T C 11: 99,799,058 (GRCm39) I87T possibly damaging Het
Lamp3 A G 16: 19,519,466 (GRCm39) L239P possibly damaging Het
Ltb4r2 A T 14: 56,000,398 (GRCm39) R340W probably benign Het
Map10 T C 8: 126,398,584 (GRCm39) V659A probably benign Het
Nars2 T A 7: 96,607,301 (GRCm39) S91T probably damaging Het
Nlrp4c A G 7: 6,075,709 (GRCm39) K667E probably benign Het
Obox3 G T 7: 15,359,724 (GRCm39) T315N possibly damaging Het
Or52e18 A T 7: 104,609,923 (GRCm39) N5K probably damaging Het
Or5b3 G A 19: 13,388,299 (GRCm39) R122H possibly damaging Het
Osgin1 A C 8: 120,171,772 (GRCm39) S189R possibly damaging Het
Pidd1 A G 7: 141,020,739 (GRCm39) F453L probably damaging Het
Pik3c2g A T 6: 139,798,589 (GRCm39) N373I probably damaging Het
Rad51b T G 12: 79,361,656 (GRCm39) S122R probably damaging Het
Rev1 T G 1: 38,093,319 (GRCm39) K1075T possibly damaging Het
Rrbp1 T G 2: 143,805,030 (GRCm39) Q1045P probably benign Het
Scg2 A C 1: 79,414,574 (GRCm39) F50V probably damaging Het
Slco1a5 A T 6: 142,213,950 (GRCm39) I57K possibly damaging Het
Tfb1m T A 17: 3,571,945 (GRCm39) R257W probably damaging Het
Tm2d3 T A 7: 65,347,498 (GRCm39) L49* probably null Het
Usp31 A G 7: 121,267,005 (GRCm39) probably null Het
Zbtb11 C T 16: 55,818,427 (GRCm39) T617I possibly damaging Het
Zfp608 A T 18: 55,031,180 (GRCm39) V920E probably damaging Het
Other mutations in Pou2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pou2f2 APN 7 24,792,125 (GRCm39) nonsense probably null
IGL01420:Pou2f2 APN 7 24,792,377 (GRCm39) missense possibly damaging 0.79
IGL02219:Pou2f2 APN 7 24,797,107 (GRCm39) missense probably damaging 1.00
IGL03038:Pou2f2 APN 7 24,796,577 (GRCm39) missense probably damaging 1.00
IGL03173:Pou2f2 APN 7 24,799,371 (GRCm39) splice site probably benign
D3080:Pou2f2 UTSW 7 24,796,558 (GRCm39) splice site probably benign
R0347:Pou2f2 UTSW 7 24,797,126 (GRCm39) missense probably damaging 1.00
R0385:Pou2f2 UTSW 7 24,815,501 (GRCm39) nonsense probably null
R0842:Pou2f2 UTSW 7 24,796,355 (GRCm39) missense probably damaging 1.00
R1665:Pou2f2 UTSW 7 24,792,149 (GRCm39) missense possibly damaging 0.66
R1914:Pou2f2 UTSW 7 24,799,581 (GRCm39) missense possibly damaging 0.71
R1915:Pou2f2 UTSW 7 24,799,581 (GRCm39) missense possibly damaging 0.71
R4811:Pou2f2 UTSW 7 24,797,111 (GRCm39) nonsense probably null
R4863:Pou2f2 UTSW 7 24,796,533 (GRCm39) intron probably benign
R5362:Pou2f2 UTSW 7 24,792,320 (GRCm39) missense probably benign 0.02
R5995:Pou2f2 UTSW 7 24,796,869 (GRCm39) missense probably damaging 1.00
R6605:Pou2f2 UTSW 7 24,793,006 (GRCm39) missense probably damaging 0.96
R7541:Pou2f2 UTSW 7 24,815,553 (GRCm39) missense probably benign 0.02
R7884:Pou2f2 UTSW 7 24,815,489 (GRCm39) missense probably benign 0.39
R8123:Pou2f2 UTSW 7 24,796,433 (GRCm39) missense possibly damaging 0.83
R8416:Pou2f2 UTSW 7 24,815,551 (GRCm39) nonsense probably null
R8499:Pou2f2 UTSW 7 24,799,623 (GRCm39) missense probably damaging 1.00
R8554:Pou2f2 UTSW 7 24,814,981 (GRCm39) intron probably benign
R9122:Pou2f2 UTSW 7 24,792,302 (GRCm39) missense probably benign
R9341:Pou2f2 UTSW 7 24,794,277 (GRCm39) missense possibly damaging 0.88
R9343:Pou2f2 UTSW 7 24,794,277 (GRCm39) missense possibly damaging 0.88
R9474:Pou2f2 UTSW 7 24,794,247 (GRCm39) missense probably benign 0.02
R9576:Pou2f2 UTSW 7 24,796,569 (GRCm39) missense probably benign 0.28
R9578:Pou2f2 UTSW 7 24,796,569 (GRCm39) missense probably benign 0.28
RF014:Pou2f2 UTSW 7 24,815,162 (GRCm39) missense unknown
Z1177:Pou2f2 UTSW 7 24,792,601 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGAGCTGAGTTCTTCCACC -3'
(R):5'- AAACGACCATTTCCCGCTTCG -3'

Sequencing Primer
(F):5'- GAGCTGAGTTCTTCCACCTGATAAC -3'
(R):5'- TTCGAGGCCCTCAACCTGAG -3'
Posted On 2017-12-01